Incidental Mutation 'R7394:Kmt2d'
ID573690
Institutional Source Beutler Lab
Gene Symbol Kmt2d
Ensembl Gene ENSMUSG00000048154
Gene Namelysine (K)-specific methyltransferase 2D
SynonymsMll2, C430014K11Rik, Mll4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location98831669-98871204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98856384 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1613 (V1613F)
Ref Sequence ENSEMBL: ENSMUSP00000023741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023741] [ENSMUST00000178486] [ENSMUST00000184363]
Predicted Effect unknown
Transcript: ENSMUST00000023741
AA Change: V1613F
SMART Domains Protein: ENSMUSP00000023741
Gene: ENSMUSG00000048154
AA Change: V1613F

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect unknown
Transcript: ENSMUST00000178486
AA Change: V1613F
SMART Domains Protein: ENSMUSP00000135941
Gene: ENSMUSG00000048154
AA Change: V1613F

DomainStartEndE-ValueType
low complexity region 135 145 N/A INTRINSIC
PHD 171 218 1.65e-5 SMART
RING 172 217 2.01e0 SMART
PHD 228 274 2.13e-8 SMART
RING 229 273 2.11e-3 SMART
PHD 275 321 1.57e-11 SMART
RING 276 320 2.36e0 SMART
low complexity region 430 489 N/A INTRINSIC
low complexity region 500 562 N/A INTRINSIC
low complexity region 564 613 N/A INTRINSIC
low complexity region 619 717 N/A INTRINSIC
internal_repeat_3 719 768 2.82e-8 PROSPERO
internal_repeat_3 773 822 2.82e-8 PROSPERO
low complexity region 826 842 N/A INTRINSIC
low complexity region 844 919 N/A INTRINSIC
low complexity region 958 981 N/A INTRINSIC
low complexity region 985 1023 N/A INTRINSIC
low complexity region 1069 1076 N/A INTRINSIC
low complexity region 1139 1153 N/A INTRINSIC
low complexity region 1259 1285 N/A INTRINSIC
low complexity region 1307 1314 N/A INTRINSIC
PHD 1335 1384 7.01e-9 SMART
RING 1336 1383 1.46e1 SMART
PHD 1385 1431 8.56e-13 SMART
PHD 1462 1513 1.11e-6 SMART
RING 1463 1512 1.46e1 SMART
low complexity region 1514 1538 N/A INTRINSIC
low complexity region 1567 1576 N/A INTRINSIC
low complexity region 1589 1612 N/A INTRINSIC
low complexity region 1634 1646 N/A INTRINSIC
low complexity region 1707 1719 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1931 1950 N/A INTRINSIC
HMG 1969 2037 6.35e-6 SMART
low complexity region 2064 2079 N/A INTRINSIC
low complexity region 2147 2167 N/A INTRINSIC
low complexity region 2170 2181 N/A INTRINSIC
low complexity region 2306 2323 N/A INTRINSIC
low complexity region 2334 2359 N/A INTRINSIC
low complexity region 2366 2388 N/A INTRINSIC
low complexity region 2402 2419 N/A INTRINSIC
low complexity region 2546 2559 N/A INTRINSIC
low complexity region 2610 2622 N/A INTRINSIC
coiled coil region 2632 2665 N/A INTRINSIC
coiled coil region 2768 2813 N/A INTRINSIC
low complexity region 2855 2868 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 3151 3165 N/A INTRINSIC
low complexity region 3189 3204 N/A INTRINSIC
low complexity region 3241 3263 N/A INTRINSIC
low complexity region 3390 3400 N/A INTRINSIC
low complexity region 3629 3659 N/A INTRINSIC
coiled coil region 3712 3749 N/A INTRINSIC
low complexity region 3781 3801 N/A INTRINSIC
coiled coil region 3910 4003 N/A INTRINSIC
low complexity region 4128 4159 N/A INTRINSIC
low complexity region 4167 4183 N/A INTRINSIC
low complexity region 4226 4246 N/A INTRINSIC
low complexity region 4266 4293 N/A INTRINSIC
low complexity region 4306 4322 N/A INTRINSIC
low complexity region 4361 4378 N/A INTRINSIC
coiled coil region 4591 4613 N/A INTRINSIC
low complexity region 4661 4684 N/A INTRINSIC
low complexity region 4745 4755 N/A INTRINSIC
low complexity region 4877 4896 N/A INTRINSIC
low complexity region 4957 4983 N/A INTRINSIC
low complexity region 4989 5029 N/A INTRINSIC
low complexity region 5100 5107 N/A INTRINSIC
PHD 5142 5188 4.67e-5 SMART
RING 5143 5187 4.87e0 SMART
FYRN 5242 5285 5.07e-21 SMART
FYRC 5291 5378 2.51e-43 SMART
SET 5448 5570 5.69e-36 SMART
PostSET 5572 5588 3.58e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184363
SMART Domains Protein: ENSMUSP00000139020
Gene: ENSMUSG00000048154

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates the Lys-4 position of histone H3. The encoded protein is part of a large protein complex called ASCOM, which has been shown to be a transcriptional regulator of the beta-globin and estrogen receptor genes. Mutations in this gene have been shown to be a cause of Kabuki syndrome. [provided by RefSeq, Oct 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality around E9.5. Mice homozygous for a conditional allele activated in different cell-types exhibit impaired adipogenesis, impaired myogenesis, perturbed germinal B cell development and promoteion of lymphomagenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Kmt2d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Kmt2d APN 15 98862333 missense unknown
IGL00927:Kmt2d APN 15 98845009 unclassified probably benign
IGL01123:Kmt2d APN 15 98837148 missense unknown
IGL01288:Kmt2d APN 15 98865044 missense probably damaging 1.00
IGL01538:Kmt2d APN 15 98860657 unclassified probably benign
IGL01575:Kmt2d APN 15 98846855 utr 3 prime probably benign
IGL01584:Kmt2d APN 15 98856369 unclassified probably benign
IGL01750:Kmt2d APN 15 98853168 unclassified probably benign
IGL02163:Kmt2d APN 15 98835228 unclassified probably benign
IGL02209:Kmt2d APN 15 98854567 unclassified probably benign
IGL02253:Kmt2d APN 15 98858175 unclassified probably benign
IGL02271:Kmt2d APN 15 98866428 missense possibly damaging 0.89
IGL02291:Kmt2d APN 15 98865492 splice site probably benign
IGL02448:Kmt2d APN 15 98844110 unclassified probably benign
IGL02472:Kmt2d APN 15 98850077 missense probably benign 0.23
IGL02496:Kmt2d APN 15 98857558 unclassified probably benign
IGL02527:Kmt2d APN 15 98841747 unclassified probably benign
IGL02576:Kmt2d APN 15 98864120 missense unknown
IGL02597:Kmt2d APN 15 98863831 missense unknown
IGL02609:Kmt2d APN 15 98851793 unclassified probably benign
IGL03085:Kmt2d APN 15 98839940 unclassified probably benign
IGL03102:Kmt2d APN 15 98855543 missense probably benign
IGL03123:Kmt2d APN 15 98861771 missense unknown
R0091:Kmt2d UTSW 15 98844479 unclassified probably benign
R0136:Kmt2d UTSW 15 98854278 unclassified probably benign
R0243:Kmt2d UTSW 15 98850137 unclassified probably benign
R0276:Kmt2d UTSW 15 98850311 unclassified probably benign
R0477:Kmt2d UTSW 15 98853581 unclassified probably benign
R0478:Kmt2d UTSW 15 98853581 unclassified probably benign
R0586:Kmt2d UTSW 15 98835207 unclassified probably benign
R0632:Kmt2d UTSW 15 98853581 unclassified probably benign
R0678:Kmt2d UTSW 15 98850413 unclassified probably benign
R0780:Kmt2d UTSW 15 98862857 missense unknown
R0891:Kmt2d UTSW 15 98852691 unclassified probably benign
R1136:Kmt2d UTSW 15 98857765 unclassified probably benign
R1417:Kmt2d UTSW 15 98866430 missense probably damaging 0.99
R1499:Kmt2d UTSW 15 98844938 unclassified probably benign
R1510:Kmt2d UTSW 15 98856377 unclassified probably benign
R1586:Kmt2d UTSW 15 98865053 splice site probably benign
R1640:Kmt2d UTSW 15 98845057 unclassified probably benign
R1714:Kmt2d UTSW 15 98862950 missense unknown
R1725:Kmt2d UTSW 15 98845234 unclassified probably benign
R1728:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1729:Kmt2d UTSW 15 98865132 missense probably damaging 1.00
R1741:Kmt2d UTSW 15 98845234 unclassified probably benign
R1744:Kmt2d UTSW 15 98865047 missense probably damaging 0.99
R1746:Kmt2d UTSW 15 98864378 missense probably damaging 0.97
R1753:Kmt2d UTSW 15 98843482 unclassified probably benign
R1782:Kmt2d UTSW 15 98857548 unclassified probably benign
R1789:Kmt2d UTSW 15 98852074 unclassified probably benign
R1802:Kmt2d UTSW 15 98862985 missense unknown
R1808:Kmt2d UTSW 15 98866686 missense probably damaging 1.00
R1822:Kmt2d UTSW 15 98861780 missense unknown
R1831:Kmt2d UTSW 15 98855343 missense probably damaging 0.97
R1920:Kmt2d UTSW 15 98855590 missense probably damaging 0.96
R1920:Kmt2d UTSW 15 98855591 missense probably damaging 1.00
R1956:Kmt2d UTSW 15 98859590 unclassified probably benign
R2100:Kmt2d UTSW 15 98846480 unclassified probably benign
R2120:Kmt2d UTSW 15 98839529 unclassified probably benign
R2188:Kmt2d UTSW 15 98839300 unclassified probably benign
R2191:Kmt2d UTSW 15 98861049 critical splice donor site probably null
R2234:Kmt2d UTSW 15 98865248 missense probably damaging 0.98
R2422:Kmt2d UTSW 15 98862266 missense unknown
R2762:Kmt2d UTSW 15 98852055 unclassified probably benign
R2895:Kmt2d UTSW 15 98843939 unclassified probably benign
R3624:Kmt2d UTSW 15 98842902 unclassified probably benign
R3791:Kmt2d UTSW 15 98844149 unclassified probably benign
R3794:Kmt2d UTSW 15 98837359 unclassified probably benign
R3871:Kmt2d UTSW 15 98851021 unclassified probably benign
R3958:Kmt2d UTSW 15 98855549 missense possibly damaging 0.69
R3983:Kmt2d UTSW 15 98846046 unclassified probably benign
R4211:Kmt2d UTSW 15 98840189 unclassified probably benign
R4212:Kmt2d UTSW 15 98845003 unclassified probably benign
R4240:Kmt2d UTSW 15 98844571 unclassified probably benign
R4246:Kmt2d UTSW 15 98840089 unclassified probably benign
R4361:Kmt2d UTSW 15 98863670 missense unknown
R4388:Kmt2d UTSW 15 98853626 unclassified probably benign
R4602:Kmt2d UTSW 15 98850259 unclassified probably benign
R4606:Kmt2d UTSW 15 98839716 unclassified probably benign
R4658:Kmt2d UTSW 15 98852529 unclassified probably benign
R4840:Kmt2d UTSW 15 98861894 missense unknown
R4895:Kmt2d UTSW 15 98844487 unclassified probably benign
R4906:Kmt2d UTSW 15 98849539 unclassified probably benign
R4976:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5093:Kmt2d UTSW 15 98856162 missense probably damaging 1.00
R5119:Kmt2d UTSW 15 98847194 utr 3 prime probably benign
R5160:Kmt2d UTSW 15 98840224 unclassified probably benign
R5260:Kmt2d UTSW 15 98842860 unclassified probably benign
R5274:Kmt2d UTSW 15 98854230 unclassified probably benign
R5450:Kmt2d UTSW 15 98855086 missense probably damaging 1.00
R5461:Kmt2d UTSW 15 98852109 unclassified probably benign
R5462:Kmt2d UTSW 15 98852109 unclassified probably benign
R5463:Kmt2d UTSW 15 98852109 unclassified probably benign
R5465:Kmt2d UTSW 15 98852109 unclassified probably benign
R5467:Kmt2d UTSW 15 98852109 unclassified probably benign
R5481:Kmt2d UTSW 15 98862005 missense unknown
R5509:Kmt2d UTSW 15 98839676 unclassified probably benign
R5534:Kmt2d UTSW 15 98837357 unclassified probably benign
R5536:Kmt2d UTSW 15 98852109 unclassified probably benign
R5537:Kmt2d UTSW 15 98852109 unclassified probably benign
R5538:Kmt2d UTSW 15 98852109 unclassified probably benign
R5546:Kmt2d UTSW 15 98853068 unclassified probably benign
R5595:Kmt2d UTSW 15 98850024 unclassified probably benign
R5645:Kmt2d UTSW 15 98844397 unclassified probably benign
R5679:Kmt2d UTSW 15 98854272 unclassified probably benign
R5710:Kmt2d UTSW 15 98854106 unclassified probably benign
R5755:Kmt2d UTSW 15 98863646 missense unknown
R5817:Kmt2d UTSW 15 98862363 missense unknown
R5841:Kmt2d UTSW 15 98852109 unclassified probably benign
R5842:Kmt2d UTSW 15 98852109 unclassified probably benign
R5843:Kmt2d UTSW 15 98852109 unclassified probably benign
R5844:Kmt2d UTSW 15 98852109 unclassified probably benign
R5845:Kmt2d UTSW 15 98852109 unclassified probably benign
R6122:Kmt2d UTSW 15 98860692 unclassified probably benign
R6612:Kmt2d UTSW 15 98845858 unclassified probably benign
R6718:Kmt2d UTSW 15 98849586 unclassified probably benign
R6718:Kmt2d UTSW 15 98850539 unclassified probably benign
R6822:Kmt2d UTSW 15 98849459 unclassified probably benign
R6866:Kmt2d UTSW 15 98857393 unclassified probably benign
R6950:Kmt2d UTSW 15 98840020 unclassified probably benign
R7089:Kmt2d UTSW 15 98850272 missense unknown
R7120:Kmt2d UTSW 15 98861065 missense unknown
R7131:Kmt2d UTSW 15 98849616 unclassified probably benign
R7177:Kmt2d UTSW 15 98850386 missense unknown
R7194:Kmt2d UTSW 15 98843833 missense unknown
R7252:Kmt2d UTSW 15 98844266 missense unknown
R7282:Kmt2d UTSW 15 98854104 missense unknown
R7307:Kmt2d UTSW 15 98849418 missense unknown
R7313:Kmt2d UTSW 15 98856623 missense unknown
R7404:Kmt2d UTSW 15 98845495 missense unknown
R7409:Kmt2d UTSW 15 98855354 missense probably damaging 1.00
R7414:Kmt2d UTSW 15 98839856 missense unknown
R7534:Kmt2d UTSW 15 98852018 missense unknown
R7575:Kmt2d UTSW 15 98849611 unclassified probably benign
R7650:Kmt2d UTSW 15 98850870 missense unknown
R7687:Kmt2d UTSW 15 98862120 missense unknown
R7699:Kmt2d UTSW 15 98843719 missense unknown
R7700:Kmt2d UTSW 15 98843719 missense unknown
R7765:Kmt2d UTSW 15 98852334 missense unknown
R7797:Kmt2d UTSW 15 98864406 missense probably benign 0.24
R7803:Kmt2d UTSW 15 98862923 missense unknown
R8054:Kmt2d UTSW 15 98843925 missense unknown
R8084:Kmt2d UTSW 15 98842064 missense unknown
R8089:Kmt2d UTSW 15 98842869 missense unknown
R8133:Kmt2d UTSW 15 98864942 missense probably damaging 1.00
R8138:Kmt2d UTSW 15 98843653 missense unknown
X0018:Kmt2d UTSW 15 98852922 unclassified probably benign
X0024:Kmt2d UTSW 15 98853053 unclassified probably benign
X0062:Kmt2d UTSW 15 98849819 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCAATGCCTGTGAGAAAGCAG -3'
(R):5'- ACGATCTGCTCAAGGGTGAAG -3'

Sequencing Primer
(F):5'- GAATGAGAAGCCACCAGAGCC -3'
(R):5'- AACAGCCCATAAGAGTTGGG -3'
Posted On2019-09-13