Incidental Mutation 'R7394:Itgb7'
ID573691
Institutional Source Beutler Lab
Gene Symbol Itgb7
Ensembl Gene ENSMUSG00000001281
Gene Nameintegrin beta 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location102215995-102231944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102219254 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 410 (S410P)
Ref Sequence ENSEMBL: ENSMUSP00000001327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001327] [ENSMUST00000118729] [ENSMUST00000119168] [ENSMUST00000119800]
Predicted Effect probably damaging
Transcript: ENSMUST00000001327
AA Change: S410P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001327
Gene: ENSMUSG00000001281
AA Change: S410P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 44 92 6.35e-6 SMART
INB 50 476 2.82e-273 SMART
VWA 151 383 7.52e-2 SMART
low complexity region 537 557 N/A INTRINSIC
Pfam:EGF_2 605 635 2.6e-7 PFAM
Integrin_B_tail 645 721 4.22e-18 SMART
low complexity region 732 744 N/A INTRINSIC
Integrin_b_cyt 746 792 7.82e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118729
SMART Domains Protein: ENSMUSP00000112985
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
low complexity region 53 62 N/A INTRINSIC
ZnF_C2H2 76 98 3.07e-1 SMART
ZnF_C2H2 104 126 1.69e-3 SMART
ZnF_C2H2 132 152 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119168
Predicted Effect probably benign
Transcript: ENSMUST00000119800
SMART Domains Protein: ENSMUSP00000113770
Gene: ENSMUSG00000046897

DomainStartEndE-ValueType
low complexity region 65 74 N/A INTRINSIC
ZnF_C2H2 88 110 3.07e-1 SMART
ZnF_C2H2 116 138 1.69e-3 SMART
ZnF_C2H2 144 164 4.99e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229440
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the integrin superfamily. Members of this family are adhesion receptors that function in signaling from the extracellular matrix to the cell. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. The encoded protein forms dimers with an alpha4 chain or an alphaE chain and plays a role in leukocyte adhesion. Dimerization with alpha4 forms a homing receptor for migration of lymphocytes to the intestinal mucosa and Peyer's patches. Dimerization with alphaE permits binding to the ligand epithelial cadherin, a calcium-dependent adhesion molecule. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous null mice display hypoplasia of gut-associated lymph tissue due to defects in lymphocyte migration [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Itgb7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01012:Itgb7 APN 15 102227585 missense probably benign 0.22
IGL01574:Itgb7 APN 15 102227540 missense possibly damaging 0.83
IGL01814:Itgb7 APN 15 102223417 missense possibly damaging 0.78
IGL01875:Itgb7 APN 15 102217995 missense probably damaging 1.00
IGL01996:Itgb7 APN 15 102217977 missense probably damaging 1.00
IGL02320:Itgb7 APN 15 102224337 missense probably benign 0.04
IGL02541:Itgb7 APN 15 102223457 missense probably benign 0.05
IGL02547:Itgb7 APN 15 102218510 missense probably damaging 1.00
R0083:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0108:Itgb7 UTSW 15 102223482 missense probably damaging 0.98
R0195:Itgb7 UTSW 15 102222183 unclassified probably benign
R1033:Itgb7 UTSW 15 102223554 missense probably damaging 1.00
R1627:Itgb7 UTSW 15 102223476 missense probably damaging 0.97
R1999:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2150:Itgb7 UTSW 15 102222118 missense probably damaging 1.00
R2331:Itgb7 UTSW 15 102223548 missense probably damaging 1.00
R3747:Itgb7 UTSW 15 102222777 missense probably damaging 1.00
R4758:Itgb7 UTSW 15 102216207 missense probably benign 0.07
R4779:Itgb7 UTSW 15 102224413 missense possibly damaging 0.54
R5134:Itgb7 UTSW 15 102217407 missense probably damaging 1.00
R5158:Itgb7 UTSW 15 102217029 missense probably benign 0.05
R5323:Itgb7 UTSW 15 102231624 intron probably benign
R5416:Itgb7 UTSW 15 102217309 missense probably benign 0.00
R5652:Itgb7 UTSW 15 102216203 missense possibly damaging 0.48
R6089:Itgb7 UTSW 15 102217286 missense probably benign 0.00
R6144:Itgb7 UTSW 15 102223482 missense probably benign 0.45
R6384:Itgb7 UTSW 15 102224451 missense probably benign 0.04
R6475:Itgb7 UTSW 15 102216266 missense probably benign 0.12
R6754:Itgb7 UTSW 15 102216160 makesense probably null
R6857:Itgb7 UTSW 15 102223465 missense probably damaging 1.00
R7747:Itgb7 UTSW 15 102216604 missense possibly damaging 0.88
R8014:Itgb7 UTSW 15 102222652 missense probably damaging 1.00
R8446:Itgb7 UTSW 15 102218608 missense probably damaging 1.00
R8523:Itgb7 UTSW 15 102216522 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGCCCGCATGGTTTCT -3'
(R):5'- TATCCCAGGGTGGTTCTTCTTT -3'

Sequencing Primer
(F):5'- CCGCATGGTTTCTCCTCC -3'
(R):5'- TTCAGAAATGAATTCTAAGTGGGCAG -3'
Posted On2019-09-13