Mutagenetix > Incidental Mutation

Incidental Mutation 'R7394:Ptk7'

573693

Institutional Source

Beutler Lab

Gene Symbol

Ptk7

Ensembl Gene

ENSMUSG00000023972

Gene Name

PTK7 protein tyrosine kinase 7

Synonyms

8430404F20Rik, mPTK7/CCK4, chz

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7394 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46564451-46629504 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 46591757 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 34 (D34G)

Ref Sequence

ENSEMBL: ENSMUSP00000043703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044442]

AlphaFold

Q8BKG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000044442
AA Change: D34G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: D34G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IGc2	36	100	1.48e-6	SMART
IGc2	133	199	8.12e-13	SMART
IGc2	229	300	5.01e-4	SMART
IGc2	326	390	1.96e-6	SMART
IG	410	491	6.02e-7	SMART
IGc2	507	569	1.19e-10	SMART
IGc2	596	663	2.6e-11	SMART
transmembrane domain	696	718	N/A	INTRINSIC
TyrKc	788	1053	4.34e-115	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	G	10: 100,609,176	I208V	probably benign	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Aldh1l2	T	A	10: 83,502,457	I646F	probably damaging	Het
Alms1	C	T	6: 85,622,223	P1344S	possibly damaging	Het
Ank2	T	A	3: 126,936,653	I711L	possibly damaging	Het
Ankrd6	T	C	4: 32,821,298	N251D	probably damaging	Het
Ap3m1	T	C	14: 21,038,079	T304A	probably benign	Het
Arhgef39	T	C	4: 43,499,532	T26A	possibly damaging	Het
C530008M17Rik	GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG	GCGCGAGGCCGAGAGGCAGG	5: 76,856,954		probably benign	Het
Carnmt1	G	T	19: 18,670,837		probably benign	Het
Ccr4	C	T	9: 114,491,926	R357H	probably benign	Het
Cd4	T	A	6: 124,873,041	M104L	probably benign	Het
Cd74	A	T	18: 60,803,893		probably benign	Het
Cdcp1	T	C	9: 123,173,813	Y731C	probably damaging	Het
Cdyl2	A	G	8: 116,624,051	S114P	not run	Het
Cenpv	T	C	11: 62,536,288	D148G	probably damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cfap57	T	A	4: 118,593,137	Y596F	probably benign	Het
Clec4a2	C	A	6: 123,139,120	A122E	unknown	Het
Col4a2	A	G	8: 11,446,184	T1602A	probably benign	Het
Cyp2j11	A	T	4: 96,316,440	Y290N	probably benign	Het
Dhx38	A	T	8: 109,556,523	V554E	probably damaging	Het
Ebf2	T	C	14: 67,237,526	V70A	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam217a	A	T	13: 34,910,279	I499K	possibly damaging	Het
Fras1	C	A	5: 96,712,450	Y2118*	probably null	Het
Gm3248	A	T	14: 5,945,781		probably null	Het
Gm5460	T	G	14: 34,043,922	D165E	possibly damaging	Het
Grk4	A	T	5: 34,751,618	N490Y	probably benign	Het
Iglc2	T	A	16: 19,195,136	K59*	probably null	Het
Iqsec3	T	A	6: 121,386,610	H895L	possibly damaging	Het
Itgb7	A	G	15: 102,219,254	S410P	probably damaging	Het
Kmt2d	C	A	15: 98,856,384	V1613F	unknown	Het
Lama1	T	C	17: 67,717,261	L118P		Het
Lrrc25	A	T	8: 70,618,180	S204C	possibly damaging	Het
Malrd1	A	G	2: 15,695,199	D619G	unknown	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Mup17	G	A	4: 61,594,398	S86F	probably benign	Het
Nbeal2	C	T	9: 110,630,189		probably null	Het
Nfkb1	A	C	3: 135,613,697	V291G	possibly damaging	Het
Nomo1	G	T	7: 46,066,479	V757F	probably benign	Het
Nutm2	T	A	13: 50,470,007	S247T	probably damaging	Het
Olfr1225	C	T	2: 89,170,361	V284I	probably benign	Het
Olfr1291-ps1	G	T	2: 111,499,896	A215S	probably damaging	Het
Olfr521	C	A	7: 99,767,346	H61Q	probably damaging	Het
Olfr826	T	A	10: 130,180,254	I209F	probably damaging	Het
Olfr834	T	A	9: 18,988,710	C241S	probably damaging	Het
Pcdhb14	A	G	18: 37,448,908	I356V	probably benign	Het
Pnkp	T	A	7: 44,858,678	S142T	probably damaging	Het
Ppia	T	C	11: 6,419,218	S99P	possibly damaging	Het
Prss47	C	T	13: 65,044,993	V325I	probably benign	Het
Pwp2	C	T	10: 78,182,480	G126R	probably damaging	Het
Rasa3	G	T	8: 13,595,353	D195E	probably benign	Het
Rnf150	T	A	8: 82,990,471	Y202*	probably null	Het
Sh2d1b2	T	C	1: 170,248,147	V50A	probably damaging	Het
Slc30a4	C	T	2: 122,685,304	V390I	possibly damaging	Het
Slc30a9	G	T	5: 67,352,766		probably null	Het
Slc8a3	T	A	12: 81,214,058		probably null	Het
Smpd3	G	A	8: 106,265,010	R304W	probably damaging	Het
Snta1	A	G	2: 154,376,860	S490P	probably damaging	Het
Srcap	T	G	7: 127,534,828	M887R	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Sult2a3	T	C	7: 14,111,524	T137A	probably benign	Het
Tspoap1	C	T	11: 87,766,119	Q367*	probably null	Het
Uroc1	C	T	6: 90,345,333	R280C	probably damaging	Het
Ush2a	T	C	1: 188,911,416	I4325T	possibly damaging	Het
Vmn1r32	A	G	6: 66,553,189	I201T	probably benign	Het
Zadh2	C	T	18: 84,088,190	A9V	probably benign	Het
Zfp651	T	A	9: 121,767,345	M626K	probably damaging	Het

Other mutations in Ptk7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Ptk7	APN	17	46574427	missense	probably damaging	1.00
IGL01064:Ptk7	APN	17	46573566	nonsense	probably null
IGL01444:Ptk7	APN	17	46565387	missense	probably damaging	1.00
IGL01477:Ptk7	APN	17	46576880	missense	possibly damaging	0.61
IGL01727:Ptk7	APN	17	46572548	missense	probably damaging	1.00
IGL01958:Ptk7	APN	17	46579427	missense	probably benign	0.37
IGL02496:Ptk7	APN	17	46590144	missense	probably benign	0.04
IGL02864:Ptk7	APN	17	46572733	missense	probably damaging	1.00
R0008:Ptk7	UTSW	17	46572762	splice site	probably benign
R0671:Ptk7	UTSW	17	46590312	missense	possibly damaging	0.94
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1464:Ptk7	UTSW	17	46572591	missense	probably damaging	1.00
R1549:Ptk7	UTSW	17	46572652	missense	probably damaging	1.00
R1635:Ptk7	UTSW	17	46573534	missense	possibly damaging	0.81
R1646:Ptk7	UTSW	17	46586297	missense	probably benign	0.44
R1846:Ptk7	UTSW	17	46576490	critical splice donor site	probably null
R1973:Ptk7	UTSW	17	46586807	nonsense	probably null
R2060:Ptk7	UTSW	17	46566238	missense	possibly damaging	0.83
R2155:Ptk7	UTSW	17	46579617	missense	probably benign	0.09
R2472:Ptk7	UTSW	17	46576848	missense	probably benign	0.35
R2937:Ptk7	UTSW	17	46572550	missense	probably damaging	0.99
R3824:Ptk7	UTSW	17	46565378	missense	probably damaging	1.00
R3845:Ptk7	UTSW	17	46586418	missense	probably benign	0.00
R4222:Ptk7	UTSW	17	46574463	missense	probably benign
R4671:Ptk7	UTSW	17	46574466	missense	probably benign
R4922:Ptk7	UTSW	17	46576491	critical splice donor site	probably null
R5319:Ptk7	UTSW	17	46572677	missense	probably damaging	1.00
R5993:Ptk7	UTSW	17	46565370	missense	probably benign
R6254:Ptk7	UTSW	17	46572642	missense	probably damaging	1.00
R6352:Ptk7	UTSW	17	46576890	missense	probably benign	0.00
R6806:Ptk7	UTSW	17	46573528	missense	probably damaging	0.99
R7338:Ptk7	UTSW	17	46579599	missense	probably benign	0.00
R7709:Ptk7	UTSW	17	46571643	missense	possibly damaging	0.81
R7949:Ptk7	UTSW	17	46586461	missense	possibly damaging	0.64
R8773:Ptk7	UTSW	17	46566267	missense	possibly damaging	0.88
R9059:Ptk7	UTSW	17	46566191	missense	probably damaging	1.00
R9327:Ptk7	UTSW	17	46568051	missense	probably benign	0.17
R9495:Ptk7	UTSW	17	46576818	missense	possibly damaging	0.82
R9514:Ptk7	UTSW	17	46576818	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TCTCCAGTGACGTTATCCCG -3'
(R):5'- GACCTCTGCAACTATAGCATTATAGC -3'

Sequencing Primer
(F):5'- AGTGACGTTATCCCGAGCCAC -3'
(R):5'- TGTTAGGATGGAGGCATC -3'

Posted On

2019-09-13