Incidental Mutation 'R7394:Ptk7'
ID 573693
Institutional Source Beutler Lab
Gene Symbol Ptk7
Ensembl Gene ENSMUSG00000023972
Gene Name PTK7 protein tyrosine kinase 7
Synonyms 8430404F20Rik, mPTK7/CCK4, chz
MMRRC Submission 045476-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7394 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 46875397-46940430 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 46902683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 34 (D34G)
Ref Sequence ENSEMBL: ENSMUSP00000043703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044442]
AlphaFold Q8BKG3
Predicted Effect probably damaging
Transcript: ENSMUST00000044442
AA Change: D34G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972
AA Change: D34G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor protein tyrosine kinase family of proteins that transduce extracellular signals across the cell membrane. The encoded protein lacks detectable catalytic tyrosine kinase activity, is involved in the Wnt signaling pathway and plays a role in multiple cellular processes including polarity and adhesion. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally with defects in neural tube closure and planar cell polarity in the ear. ENU-induced mutant mice show omphalocele, impaired neural tube, heart and lung development, rib defects, polydactyly, failed eyelid closure and altered cell polarity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,445,038 (GRCm39) I208V probably benign Het
Abcb11 C T 2: 69,130,211 (GRCm39) D282N probably damaging Het
Aldh1l2 T A 10: 83,338,321 (GRCm39) I646F probably damaging Het
Alms1 C T 6: 85,599,205 (GRCm39) P1344S possibly damaging Het
Ank2 T A 3: 126,730,302 (GRCm39) I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 (GRCm39) N251D probably damaging Het
Ap3m1 T C 14: 21,088,147 (GRCm39) T304A probably benign Het
Arhgef39 T C 4: 43,499,532 (GRCm39) T26A possibly damaging Het
Carnmt1 G T 19: 18,648,201 (GRCm39) probably benign Het
Ccr4 C T 9: 114,320,994 (GRCm39) R357H probably benign Het
Cd4 T A 6: 124,850,004 (GRCm39) M104L probably benign Het
Cd74 A T 18: 60,936,965 (GRCm39) probably benign Het
Cdcp1 T C 9: 123,002,878 (GRCm39) Y731C probably damaging Het
Cdyl2 A G 8: 117,350,790 (GRCm39) S114P not run Het
Cenpv T C 11: 62,427,114 (GRCm39) D148G probably damaging Het
Cep89 G A 7: 35,129,353 (GRCm39) R630H probably damaging Het
Cfap57 T A 4: 118,450,334 (GRCm39) Y596F probably benign Het
Clec4a2 C A 6: 123,116,079 (GRCm39) A122E unknown Het
Col4a2 A G 8: 11,496,184 (GRCm39) T1602A probably benign Het
Cracd GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 77,004,801 (GRCm39) probably benign Het
Cyp2j11 A T 4: 96,204,677 (GRCm39) Y290N probably benign Het
Dhx38 A T 8: 110,283,155 (GRCm39) V554E probably damaging Het
Ebf2 T C 14: 67,474,975 (GRCm39) V70A probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Fam217a A T 13: 35,094,262 (GRCm39) I499K possibly damaging Het
Fras1 C A 5: 96,860,309 (GRCm39) Y2118* probably null Het
Gm3248 A T 14: 5,945,781 (GRCm38) probably null Het
Gm5460 T G 14: 33,765,879 (GRCm39) D165E possibly damaging Het
Grk4 A T 5: 34,908,962 (GRCm39) N490Y probably benign Het
Iglc2 T A 16: 19,013,886 (GRCm39) K59* probably null Het
Iqsec3 T A 6: 121,363,569 (GRCm39) H895L possibly damaging Het
Itgb7 A G 15: 102,127,689 (GRCm39) S410P probably damaging Het
Kmt2d C A 15: 98,754,265 (GRCm39) V1613F unknown Het
Lama1 T C 17: 68,024,256 (GRCm39) L118P Het
Lrrc25 A T 8: 71,070,830 (GRCm39) S204C possibly damaging Het
Malrd1 A G 2: 15,700,010 (GRCm39) D619G unknown Het
Ms4a6d G A 19: 11,567,437 (GRCm39) Q155* probably null Het
Mup17 G A 4: 61,512,635 (GRCm39) S86F probably benign Het
Nbeal2 C T 9: 110,459,257 (GRCm39) probably null Het
Nfkb1 A C 3: 135,319,458 (GRCm39) V291G possibly damaging Het
Nomo1 G T 7: 45,715,903 (GRCm39) V757F probably benign Het
Nutm2 T A 13: 50,624,043 (GRCm39) S247T probably damaging Het
Or2at1 C A 7: 99,416,553 (GRCm39) H61Q probably damaging Het
Or4c120 C T 2: 89,000,705 (GRCm39) V284I probably benign Het
Or4f4-ps1 G T 2: 111,330,241 (GRCm39) A215S probably damaging Het
Or7g12 T A 9: 18,900,006 (GRCm39) C241S probably damaging Het
Or9k2b T A 10: 130,016,123 (GRCm39) I209F probably damaging Het
Pcdhb14 A G 18: 37,581,961 (GRCm39) I356V probably benign Het
Pnkp T A 7: 44,508,102 (GRCm39) S142T probably damaging Het
Ppia T C 11: 6,369,218 (GRCm39) S99P possibly damaging Het
Prss47 C T 13: 65,192,807 (GRCm39) V325I probably benign Het
Ptgr3 C T 18: 84,106,315 (GRCm39) A9V probably benign Het
Pwp2 C T 10: 78,018,314 (GRCm39) G126R probably damaging Het
Rasa3 G T 8: 13,645,353 (GRCm39) D195E probably benign Het
Rnf150 T A 8: 83,717,100 (GRCm39) Y202* probably null Het
Sh2d1b2 T C 1: 170,075,716 (GRCm39) V50A probably damaging Het
Slc30a4 C T 2: 122,527,224 (GRCm39) V390I possibly damaging Het
Slc30a9 G T 5: 67,510,109 (GRCm39) probably null Het
Slc8a3 T A 12: 81,260,832 (GRCm39) probably null Het
Smpd3 G A 8: 106,991,642 (GRCm39) R304W probably damaging Het
Snta1 A G 2: 154,218,780 (GRCm39) S490P probably damaging Het
Srcap T G 7: 127,134,000 (GRCm39) M887R probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Sult2a3 T C 7: 13,845,449 (GRCm39) T137A probably benign Het
Tspoap1 C T 11: 87,656,945 (GRCm39) Q367* probably null Het
Uroc1 C T 6: 90,322,315 (GRCm39) R280C probably damaging Het
Ush2a T C 1: 188,643,613 (GRCm39) I4325T possibly damaging Het
Vmn1r32 A G 6: 66,530,173 (GRCm39) I201T probably benign Het
Zbtb47 T A 9: 121,596,411 (GRCm39) M626K probably damaging Het
Other mutations in Ptk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Ptk7 APN 17 46,885,353 (GRCm39) missense probably damaging 1.00
IGL01064:Ptk7 APN 17 46,884,492 (GRCm39) nonsense probably null
IGL01444:Ptk7 APN 17 46,876,313 (GRCm39) missense probably damaging 1.00
IGL01477:Ptk7 APN 17 46,887,806 (GRCm39) missense possibly damaging 0.61
IGL01727:Ptk7 APN 17 46,883,474 (GRCm39) missense probably damaging 1.00
IGL01958:Ptk7 APN 17 46,890,353 (GRCm39) missense probably benign 0.37
IGL02496:Ptk7 APN 17 46,901,070 (GRCm39) missense probably benign 0.04
IGL02864:Ptk7 APN 17 46,883,659 (GRCm39) missense probably damaging 1.00
R0008:Ptk7 UTSW 17 46,883,688 (GRCm39) splice site probably benign
R0671:Ptk7 UTSW 17 46,901,238 (GRCm39) missense possibly damaging 0.94
R1464:Ptk7 UTSW 17 46,883,517 (GRCm39) missense probably damaging 1.00
R1464:Ptk7 UTSW 17 46,883,517 (GRCm39) missense probably damaging 1.00
R1549:Ptk7 UTSW 17 46,883,578 (GRCm39) missense probably damaging 1.00
R1635:Ptk7 UTSW 17 46,884,460 (GRCm39) missense possibly damaging 0.81
R1646:Ptk7 UTSW 17 46,897,223 (GRCm39) missense probably benign 0.44
R1846:Ptk7 UTSW 17 46,887,416 (GRCm39) critical splice donor site probably null
R1973:Ptk7 UTSW 17 46,897,733 (GRCm39) nonsense probably null
R2060:Ptk7 UTSW 17 46,877,164 (GRCm39) missense possibly damaging 0.83
R2155:Ptk7 UTSW 17 46,890,543 (GRCm39) missense probably benign 0.09
R2472:Ptk7 UTSW 17 46,887,774 (GRCm39) missense probably benign 0.35
R2937:Ptk7 UTSW 17 46,883,476 (GRCm39) missense probably damaging 0.99
R3824:Ptk7 UTSW 17 46,876,304 (GRCm39) missense probably damaging 1.00
R3845:Ptk7 UTSW 17 46,897,344 (GRCm39) missense probably benign 0.00
R4222:Ptk7 UTSW 17 46,885,389 (GRCm39) missense probably benign
R4671:Ptk7 UTSW 17 46,885,392 (GRCm39) missense probably benign
R4922:Ptk7 UTSW 17 46,887,417 (GRCm39) critical splice donor site probably null
R5319:Ptk7 UTSW 17 46,883,603 (GRCm39) missense probably damaging 1.00
R5993:Ptk7 UTSW 17 46,876,296 (GRCm39) missense probably benign
R6254:Ptk7 UTSW 17 46,883,568 (GRCm39) missense probably damaging 1.00
R6352:Ptk7 UTSW 17 46,887,816 (GRCm39) missense probably benign 0.00
R6806:Ptk7 UTSW 17 46,884,454 (GRCm39) missense probably damaging 0.99
R7338:Ptk7 UTSW 17 46,890,525 (GRCm39) missense probably benign 0.00
R7709:Ptk7 UTSW 17 46,882,569 (GRCm39) missense possibly damaging 0.81
R7949:Ptk7 UTSW 17 46,897,387 (GRCm39) missense possibly damaging 0.64
R8773:Ptk7 UTSW 17 46,877,193 (GRCm39) missense possibly damaging 0.88
R9059:Ptk7 UTSW 17 46,877,117 (GRCm39) missense probably damaging 1.00
R9327:Ptk7 UTSW 17 46,878,977 (GRCm39) missense probably benign 0.17
R9495:Ptk7 UTSW 17 46,887,744 (GRCm39) missense possibly damaging 0.82
R9514:Ptk7 UTSW 17 46,887,744 (GRCm39) missense possibly damaging 0.82
R9638:Ptk7 UTSW 17 46,890,519 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCTCCAGTGACGTTATCCCG -3'
(R):5'- GACCTCTGCAACTATAGCATTATAGC -3'

Sequencing Primer
(F):5'- AGTGACGTTATCCCGAGCCAC -3'
(R):5'- TGTTAGGATGGAGGCATC -3'
Posted On 2019-09-13