Mutagenetix > Incidental Mutation

Incidental Mutation 'R7394:Cd74'

573696

Institutional Source

Beutler Lab

Gene Symbol

Cd74

Ensembl Gene

ENSMUSG00000024610

Gene Name

CD74 antigen (invariant polypeptide of major histocompatibility complex, class II antigen-associated)

Synonyms

Ii, CLIP

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R7394 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

60803848-60812646 bp(+) (GRCm38)

Type of Mutation

start gained

DNA Base Change (assembly)

A to T at 60803893 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000126688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000050487] [ENSMUST00000097563] [ENSMUST00000167610]

AlphaFold

P04441

Predicted Effect

probably benign
Transcript: ENSMUST00000050487

SMART Domains

Protein: ENSMUSP00000057836
Gene: ENSMUSG00000024610

Domain	Start	End	E-Value	Type
Pfam:MHC2-interact	1	112	2.8e-40	PFAM
Pfam:MHCassoc_trimer	119	190	6e-36	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097563

SMART Domains

Protein: ENSMUSP00000095171
Gene: ENSMUSG00000024610

Domain	Start	End	E-Value	Type
Pfam:MHC2-interact	1	112	5.3e-40	PFAM
Pfam:MHCassoc_trimer	119	190	6.7e-36	PFAM
TY	212	258	8.6e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167610

SMART Domains

Protein: ENSMUSP00000126688
Gene: ENSMUSG00000024610

Domain	Start	End	E-Value	Type
Pfam:MHC2-interact	1	112	5.8e-45	PFAM
Pfam:MHCassoc_trimer	119	187	1.7e-34	PFAM
TY	212	258	8.6e-18	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (66/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with class II major histocompatibility complex (MHC) and is an important chaperone that regulates antigen presentation for immune response. It also serves as cell surface receptor for the cytokine macrophage migration inhibitory factor (MIF) which, when bound to the encoded protein, initiates survival pathways and cell proliferation. This protein also interacts with amyloid precursor protein (APP) and suppresses the production of amyloid beta (Abeta). Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired transport of MHC class II molecules, poor antigen presentation, and deficiency of CD4+ T cell development and positive selection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017N19Rik	A	G	10: 100,609,176	I208V	probably benign	Het
Abcb11	C	T	2: 69,299,867	D282N	probably damaging	Het
Aldh1l2	T	A	10: 83,502,457	I646F	probably damaging	Het
Alms1	C	T	6: 85,622,223	P1344S	possibly damaging	Het
Ank2	T	A	3: 126,936,653	I711L	possibly damaging	Het
Ankrd6	T	C	4: 32,821,298	N251D	probably damaging	Het
Ap3m1	T	C	14: 21,038,079	T304A	probably benign	Het
Arhgef39	T	C	4: 43,499,532	T26A	possibly damaging	Het
C530008M17Rik	GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG	GCGCGAGGCCGAGAGGCAGG	5: 76,856,954		probably benign	Het
Carnmt1	G	T	19: 18,670,837		probably benign	Het
Ccr4	C	T	9: 114,491,926	R357H	probably benign	Het
Cd4	T	A	6: 124,873,041	M104L	probably benign	Het
Cdcp1	T	C	9: 123,173,813	Y731C	probably damaging	Het
Cdyl2	A	G	8: 116,624,051	S114P	not run	Het
Cenpv	T	C	11: 62,536,288	D148G	probably damaging	Het
Cep89	G	A	7: 35,429,928	R630H	probably damaging	Het
Cfap57	T	A	4: 118,593,137	Y596F	probably benign	Het
Clec4a2	C	A	6: 123,139,120	A122E	unknown	Het
Col4a2	A	G	8: 11,446,184	T1602A	probably benign	Het
Cyp2j11	A	T	4: 96,316,440	Y290N	probably benign	Het
Dhx38	A	T	8: 109,556,523	V554E	probably damaging	Het
Ebf2	T	C	14: 67,237,526	V70A	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fam217a	A	T	13: 34,910,279	I499K	possibly damaging	Het
Fras1	C	A	5: 96,712,450	Y2118*	probably null	Het
Gm3248	A	T	14: 5,945,781		probably null	Het
Gm5460	T	G	14: 34,043,922	D165E	possibly damaging	Het
Grk4	A	T	5: 34,751,618	N490Y	probably benign	Het
Iglc2	T	A	16: 19,195,136	K59*	probably null	Het
Iqsec3	T	A	6: 121,386,610	H895L	possibly damaging	Het
Itgb7	A	G	15: 102,219,254	S410P	probably damaging	Het
Kmt2d	C	A	15: 98,856,384	V1613F	unknown	Het
Lama1	T	C	17: 67,717,261	L118P		Het
Lrrc25	A	T	8: 70,618,180	S204C	possibly damaging	Het
Malrd1	A	G	2: 15,695,199	D619G	unknown	Het
Ms4a6d	G	A	19: 11,590,073	Q155*	probably null	Het
Mup17	G	A	4: 61,594,398	S86F	probably benign	Het
Nbeal2	C	T	9: 110,630,189		probably null	Het
Nfkb1	A	C	3: 135,613,697	V291G	possibly damaging	Het
Nomo1	G	T	7: 46,066,479	V757F	probably benign	Het
Nutm2	T	A	13: 50,470,007	S247T	probably damaging	Het
Olfr1225	C	T	2: 89,170,361	V284I	probably benign	Het
Olfr1291-ps1	G	T	2: 111,499,896	A215S	probably damaging	Het
Olfr521	C	A	7: 99,767,346	H61Q	probably damaging	Het
Olfr826	T	A	10: 130,180,254	I209F	probably damaging	Het
Olfr834	T	A	9: 18,988,710	C241S	probably damaging	Het
Pcdhb14	A	G	18: 37,448,908	I356V	probably benign	Het
Pnkp	T	A	7: 44,858,678	S142T	probably damaging	Het
Ppia	T	C	11: 6,419,218	S99P	possibly damaging	Het
Prss47	C	T	13: 65,044,993	V325I	probably benign	Het
Ptk7	T	C	17: 46,591,757	D34G	probably damaging	Het
Pwp2	C	T	10: 78,182,480	G126R	probably damaging	Het
Rasa3	G	T	8: 13,595,353	D195E	probably benign	Het
Rnf150	T	A	8: 82,990,471	Y202*	probably null	Het
Sh2d1b2	T	C	1: 170,248,147	V50A	probably damaging	Het
Slc30a4	C	T	2: 122,685,304	V390I	possibly damaging	Het
Slc30a9	G	T	5: 67,352,766		probably null	Het
Slc8a3	T	A	12: 81,214,058		probably null	Het
Smpd3	G	A	8: 106,265,010	R304W	probably damaging	Het
Snta1	A	G	2: 154,376,860	S490P	probably damaging	Het
Srcap	T	G	7: 127,534,828	M887R	probably damaging	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Sult2a3	T	C	7: 14,111,524	T137A	probably benign	Het
Tspoap1	C	T	11: 87,766,119	Q367*	probably null	Het
Uroc1	C	T	6: 90,345,333	R280C	probably damaging	Het
Ush2a	T	C	1: 188,911,416	I4325T	possibly damaging	Het
Vmn1r32	A	G	6: 66,553,189	I201T	probably benign	Het
Zadh2	C	T	18: 84,088,190	A9V	probably benign	Het
Zfp651	T	A	9: 121,767,345	M626K	probably damaging	Het

Other mutations in Cd74

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00980:Cd74	APN	18	60811326	missense	probably benign	0.02
IGL01475:Cd74	APN	18	60810321	unclassified	probably benign
IGL01867:Cd74	APN	18	60808280	missense	probably benign	0.03
IGL03207:Cd74	APN	18	60811924	unclassified	probably benign
R0010:Cd74	UTSW	18	60803896	start gained	probably benign
R0010:Cd74	UTSW	18	60809071	missense	probably benign	0.06
R0010:Cd74	UTSW	18	60809071	missense	probably benign	0.06
R0416:Cd74	UTSW	18	60811414	missense	possibly damaging	0.90
R0652:Cd74	UTSW	18	60811885	missense	probably damaging	1.00
R1433:Cd74	UTSW	18	60803992	missense	probably benign	0.04
R1490:Cd74	UTSW	18	60811366	missense	probably damaging	1.00
R1762:Cd74	UTSW	18	60811318	missense	probably benign	0.00
R1869:Cd74	UTSW	18	60810412	missense	probably benign	0.18
R4957:Cd74	UTSW	18	60809037	missense	probably benign	0.01
R5433:Cd74	UTSW	18	60807921	missense	probably benign	0.21
R5513:Cd74	UTSW	18	60811305	missense	probably damaging	1.00
R6073:Cd74	UTSW	18	60811486	critical splice donor site	probably null
R6381:Cd74	UTSW	18	60811363	missense	probably damaging	1.00
R8944:Cd74	UTSW	18	60810055	missense	probably damaging	1.00
R9252:Cd74	UTSW	18	60808292	missense	possibly damaging	0.50
R9256:Cd74	UTSW	18	60811294	missense	probably benign	0.03
X0011:Cd74	UTSW	18	60811487	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GATCATGCAGGCCTTTCTACC -3'
(R):5'- GCATTCTGTGTCCTCCAGAG -3'

Sequencing Primer
(F):5'- CCAGGGAGGCAGCTTTGAG -3'
(R):5'- TCCAGAGGTAAGGGCTCTCTG -3'

Posted On

2019-09-13