Incidental Mutation 'R7394:Ms4a6d'
ID573698
Institutional Source Beutler Lab
Gene Symbol Ms4a6d
Ensembl Gene ENSMUSG00000024679
Gene Namemembrane-spanning 4-domains, subfamily A, member 6D
SynonymsMs4a11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location11586604-11604849 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 11590073 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 155 (Q155*)
Ref Sequence ENSEMBL: ENSMUSP00000025582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025582] [ENSMUST00000125291]
Predicted Effect probably null
Transcript: ENSMUST00000025582
AA Change: Q155*
SMART Domains Protein: ENSMUSP00000025582
Gene: ENSMUSG00000024679
AA Change: Q155*

DomainStartEndE-ValueType
Pfam:CD20 47 207 2.8e-42 PFAM
low complexity region 222 235 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125291
AA Change: Q47*
SMART Domains Protein: ENSMUSP00000115142
Gene: ENSMUSG00000024679
AA Change: Q47*

DomainStartEndE-ValueType
Pfam:CD20 1 99 3.7e-15 PFAM
low complexity region 114 127 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cep89 G A 7: 35,429,928 R630H probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Ms4a6d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Ms4a6d APN 19 11601885 missense probably damaging 0.99
IGL01638:Ms4a6d APN 19 11587168 missense probably damaging 0.99
IGL01799:Ms4a6d APN 19 11590135 missense probably damaging 1.00
IGL02304:Ms4a6d APN 19 11603141 splice site probably benign
R1873:Ms4a6d UTSW 19 11601859 missense probably damaging 1.00
R1993:Ms4a6d UTSW 19 11590159 missense probably damaging 1.00
R2443:Ms4a6d UTSW 19 11590193 missense possibly damaging 0.93
R2900:Ms4a6d UTSW 19 11590144 missense probably damaging 1.00
R5288:Ms4a6d UTSW 19 11587136 missense possibly damaging 0.78
R6251:Ms4a6d UTSW 19 11587140 missense probably damaging 0.99
R7339:Ms4a6d UTSW 19 11590073 nonsense probably null
R7340:Ms4a6d UTSW 19 11590073 nonsense probably null
R7341:Ms4a6d UTSW 19 11590073 nonsense probably null
R7342:Ms4a6d UTSW 19 11590073 nonsense probably null
R7347:Ms4a6d UTSW 19 11590073 nonsense probably null
R7348:Ms4a6d UTSW 19 11590073 nonsense probably null
R7350:Ms4a6d UTSW 19 11590073 nonsense probably null
R7368:Ms4a6d UTSW 19 11590073 nonsense probably null
R7393:Ms4a6d UTSW 19 11590073 nonsense probably null
R8020:Ms4a6d UTSW 19 11590108 missense probably benign 0.00
R8181:Ms4a6d UTSW 19 11603289 missense probably damaging 0.99
R8785:Ms4a6d UTSW 19 11593036 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TGAACAGAGTTTTGAATCAGGGAAC -3'
(R):5'- TGTTTGCAGACACTAGAGGGC -3'

Sequencing Primer
(F):5'- TCAGGGAACAGAAGAAATATGCTGTC -3'
(R):5'- CAAGCAGCTGGGCCTATTATAGTG -3'
Posted On2019-09-13