Incidental Mutation 'R7395:Serpine2'
ID573701
Institutional Source Beutler Lab
Gene Symbol Serpine2
Ensembl Gene ENSMUSG00000026249
Gene Nameserine (or cysteine) peptidase inhibitor, clade E, member 2
Synonymsprotease nexin 1, Spi4, B230326M24Rik, nexin, PN-1, PI7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7395 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location79794197-79861180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79801555 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 296 (F296L)
Ref Sequence ENSEMBL: ENSMUSP00000027467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027467] [ENSMUST00000189793] [ENSMUST00000190724]
Predicted Effect probably damaging
Transcript: ENSMUST00000027467
AA Change: F296L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027467
Gene: ENSMUSG00000026249
AA Change: F296L

DomainStartEndE-ValueType
SERPIN 36 397 9.93e-152 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189793
AA Change: F149L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140065
Gene: ENSMUSG00000026249
AA Change: F149L

DomainStartEndE-ValueType
SERPIN 1 231 2.3e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190724
SMART Domains Protein: ENSMUSP00000140255
Gene: ENSMUSG00000026249

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SERPIN 36 232 7.1e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serpin family of proteins, a group of proteins that inhibit serine proteases. Thrombin, urokinase, plasmin and trypsin are among the proteases that this family member can inhibit. This gene is a susceptibility gene for chronic obstructive pulmonary disease and for emphysema. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a targeted mutation of this gene are viable and healthy but develop epileptic activity as well as reduced theta burst-induced LTP and NMDA receptor-mediated synaptic transmission in the CA1 field of the hippocampus; notably, homozygous mutant males are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
4930433I11Rik A T 7: 40,989,678 T13S probably damaging Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
B3glct A G 5: 149,725,604 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dcun1d2 G A 8: 13,278,675 R75* probably null Het
Defb19 A T 2: 152,580,023 probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tcstv1 A T 13: 119,894,130 probably null Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Tph1 C T 7: 46,657,203 probably null Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Ulk4 T A 9: 121,255,112 Q129L probably benign Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Serpine2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Serpine2 APN 1 79810694 missense probably damaging 0.98
IGL01386:Serpine2 APN 1 79801551 missense probably damaging 0.97
IGL02069:Serpine2 APN 1 79821412 missense possibly damaging 0.94
IGL02516:Serpine2 APN 1 79794997 unclassified probably benign
IGL02743:Serpine2 APN 1 79801555 missense probably damaging 1.00
R0372:Serpine2 UTSW 1 79821430 missense probably damaging 0.98
R1519:Serpine2 UTSW 1 79795031 missense probably damaging 1.00
R1768:Serpine2 UTSW 1 79816815 missense probably damaging 1.00
R1993:Serpine2 UTSW 1 79821442 missense probably damaging 1.00
R1995:Serpine2 UTSW 1 79821442 missense probably damaging 1.00
R2034:Serpine2 UTSW 1 79796852 missense probably damaging 1.00
R2094:Serpine2 UTSW 1 79810694 missense probably damaging 0.98
R2311:Serpine2 UTSW 1 79810548 splice site probably benign
R2312:Serpine2 UTSW 1 79802853 missense probably damaging 1.00
R2519:Serpine2 UTSW 1 79799539 missense possibly damaging 0.55
R4844:Serpine2 UTSW 1 79799524 nonsense probably null
R5141:Serpine2 UTSW 1 79802863 missense possibly damaging 0.92
R5386:Serpine2 UTSW 1 79821287 nonsense probably null
R5422:Serpine2 UTSW 1 79816875 missense probably benign 0.03
R5422:Serpine2 UTSW 1 79821489 missense probably benign 0.10
R5786:Serpine2 UTSW 1 79816920 missense probably benign 0.02
R5794:Serpine2 UTSW 1 79821439 missense probably benign
R6109:Serpine2 UTSW 1 79810671 missense probably damaging 1.00
R6514:Serpine2 UTSW 1 79821570 splice site probably null
R6544:Serpine2 UTSW 1 79803130 splice site probably null
R7001:Serpine2 UTSW 1 79795031 missense probably damaging 1.00
R7660:Serpine2 UTSW 1 79802905 missense probably benign 0.07
R7844:Serpine2 UTSW 1 79816799 missense probably benign
R8873:Serpine2 UTSW 1 79821550 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTTTAGGGCAACATACTCCCG -3'
(R):5'- TGGCCATGCTCATTGTGAGTAAG -3'

Sequencing Primer
(F):5'- AGGGCAACATACTCCCGATTTTC -3'
(R):5'- CCATGCTCATTGTGAGTAAGAAGAG -3'
Posted On2019-09-13