Incidental Mutation 'R7395:Crocc2'
ID 573703
Institutional Source Beutler Lab
Gene Symbol Crocc2
Ensembl Gene ENSMUSG00000084989
Gene Name ciliary rootlet coiled-coil, rootletin family member 2
Synonyms E030010N08Rik, LOC381284
MMRRC Submission 045477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R7395 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 93096447-93158794 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 93143829 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 1403 (Q1403*)
Ref Sequence ENSEMBL: ENSMUSP00000120588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138595]
AlphaFold F6XLV1
Predicted Effect probably null
Transcript: ENSMUST00000138595
AA Change: Q1403*
SMART Domains Protein: ENSMUSP00000120588
Gene: ENSMUSG00000084989
AA Change: Q1403*

DomainStartEndE-ValueType
low complexity region 67 82 N/A INTRINSIC
Pfam:Rootletin 89 260 5.1e-24 PFAM
coiled coil region 281 346 N/A INTRINSIC
internal_repeat_1 381 424 9.68e-9 PROSPERO
internal_repeat_3 389 414 5.46e-6 PROSPERO
internal_repeat_4 398 425 1.1e-5 PROSPERO
coiled coil region 426 627 N/A INTRINSIC
coiled coil region 655 1247 N/A INTRINSIC
internal_repeat_2 1252 1280 6.61e-7 PROSPERO
internal_repeat_4 1341 1374 1.1e-5 PROSPERO
internal_repeat_1 1347 1384 9.68e-9 PROSPERO
coiled coil region 1403 1512 N/A INTRINSIC
coiled coil region 1539 1582 N/A INTRINSIC
low complexity region 1590 1604 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 55,184,140 (GRCm39) probably null Het
4930433I11Rik A T 7: 40,639,102 (GRCm39) T13S probably damaging Het
Abca13 A G 11: 9,241,658 (GRCm39) I1174V probably benign Het
Acoxl G A 2: 127,726,336 (GRCm39) V237M probably damaging Het
Adam33 A C 2: 130,903,089 (GRCm39) W52G probably benign Het
Adgrv1 T C 13: 81,707,467 (GRCm39) H1313R probably damaging Het
Ap3d1 T C 10: 80,566,716 (GRCm39) T89A probably benign Het
Armc8 T C 9: 99,415,185 (GRCm39) E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,949 (GRCm39) *383Q probably null Het
Atp8b4 A T 2: 126,217,614 (GRCm39) L634Q possibly damaging Het
B3glct A G 5: 149,649,069 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Bicd2 A G 13: 49,531,706 (GRCm39) D316G possibly damaging Het
Bop1 A T 15: 76,338,041 (GRCm39) S610T probably damaging Het
Car11 T A 7: 45,350,745 (GRCm39) Y80* probably null Het
Ccdc121rt2 A T 5: 112,598,035 (GRCm39) E194V possibly damaging Het
Ccdc96 T C 5: 36,642,609 (GRCm39) I205T probably benign Het
Ces2a A G 8: 105,466,273 (GRCm39) E390G probably benign Het
Cfap54 C A 10: 92,720,565 (GRCm39) V2630L unknown Het
Chek2 G T 5: 111,019,974 (GRCm39) probably null Het
Cntn3 C T 6: 102,314,355 (GRCm39) probably null Het
Cpne3 A T 4: 19,528,239 (GRCm39) D339E probably damaging Het
Crppa A T 12: 36,551,994 (GRCm39) I283F possibly damaging Het
Csnka2ip G A 16: 64,299,803 (GRCm39) T187I Het
Ctu1 A G 7: 43,326,019 (GRCm39) H226R possibly damaging Het
Cubn G T 2: 13,291,875 (GRCm39) Q3317K probably damaging Het
Cyp17a1 A G 19: 46,659,134 (GRCm39) L169P probably benign Het
Dcc T A 18: 71,507,640 (GRCm39) K911* probably null Het
Dcun1d2 G A 8: 13,328,675 (GRCm39) R75* probably null Het
Defb19 A T 2: 152,421,943 (GRCm39) probably null Het
Dffb A T 4: 154,053,570 (GRCm39) S257R probably damaging Het
Dip2c A C 13: 9,664,413 (GRCm39) N942T probably damaging Het
Dnah3 T A 7: 119,565,474 (GRCm39) I169F Het
Dnah3 T C 7: 119,660,183 (GRCm39) M830V probably benign Het
Dnajc5g G A 5: 31,269,009 (GRCm39) S130N possibly damaging Het
Dscaml1 C A 9: 45,613,703 (GRCm39) Q939K possibly damaging Het
Evpl G C 11: 116,117,905 (GRCm39) N761K possibly damaging Het
Fbxw8 A T 5: 118,206,280 (GRCm39) I556N probably damaging Het
Fry G T 5: 150,304,348 (GRCm39) M579I possibly damaging Het
Ggt7 A T 2: 155,337,800 (GRCm39) M488K probably benign Het
Gnpnat1 T A 14: 45,619,038 (GRCm39) H107L probably benign Het
Golga2 C A 2: 32,195,599 (GRCm39) P798Q possibly damaging Het
Gpr35 G A 1: 92,910,929 (GRCm39) A214T probably damaging Het
Greb1 A T 12: 16,759,431 (GRCm39) probably null Het
Hdac10 G A 15: 89,012,487 (GRCm39) T32I probably benign Het
Hkdc1 G A 10: 62,221,478 (GRCm39) T860I probably damaging Het
Icam5 C A 9: 20,946,738 (GRCm39) P422Q possibly damaging Het
Ist1 A C 8: 110,404,159 (GRCm39) S238A probably benign Het
Lrig2 T C 3: 104,404,836 (GRCm39) N91D probably benign Het
Mapt A C 11: 104,218,949 (GRCm39) D352A probably damaging Het
Micall2 G A 5: 139,702,124 (GRCm39) P373L possibly damaging Het
Mocs1 A G 17: 49,761,585 (GRCm39) S560G possibly damaging Het
Mpo A G 11: 87,691,950 (GRCm39) D461G probably damaging Het
Myo1a G T 10: 127,546,309 (GRCm39) V271L probably damaging Het
Ncoa1 G A 12: 4,345,188 (GRCm39) P720S not run Het
Ncr1 T A 7: 4,341,150 (GRCm39) I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 (GRCm39) R66C probably damaging Het
Obox5 A T 7: 15,492,668 (GRCm39) S208C probably damaging Het
Or10q1 T C 19: 13,726,502 (GRCm39) S11P probably damaging Het
Or2n1d A T 17: 38,646,755 (GRCm39) K236* probably null Het
Or5p75-ps1 T A 7: 108,107,611 (GRCm39) F116Y unknown Het
Or7d9 T A 9: 20,197,826 (GRCm39) M285K probably damaging Het
Padi4 A C 4: 140,488,983 (GRCm39) V152G probably damaging Het
Pdzd7 A T 19: 45,025,450 (GRCm39) D348E probably damaging Het
Pdzph1 T A 17: 59,186,154 (GRCm39) K1212N possibly damaging Het
Piezo2 C T 18: 63,160,634 (GRCm39) G2341R probably damaging Het
Plb1 A G 5: 32,511,028 (GRCm39) K1298E probably benign Het
Prr14l A G 5: 32,985,982 (GRCm39) L1171P probably benign Het
Rab11fip5 T C 6: 85,318,850 (GRCm39) T680A probably benign Het
Rev1 A T 1: 38,127,146 (GRCm39) N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Ryr2 A G 13: 11,799,997 (GRCm39) C917R probably damaging Het
Sall1 A T 8: 89,757,549 (GRCm39) S852T possibly damaging Het
Serpine2 A G 1: 79,779,272 (GRCm39) F296L probably damaging Het
Slc12a6 A T 2: 112,182,887 (GRCm39) N754I probably damaging Het
Slc39a6 A T 18: 24,718,332 (GRCm39) L575Q probably damaging Het
Smarcc2 T A 10: 128,321,475 (GRCm39) L890Q probably damaging Het
Smg5 T A 3: 88,268,378 (GRCm39) V1006D probably damaging Het
Ssh2 T C 11: 77,283,899 (GRCm39) V51A probably damaging Het
St14 T C 9: 31,008,195 (GRCm39) K547E probably benign Het
Stag1 T G 9: 100,678,781 (GRCm39) V234G probably damaging Het
Stag3 A T 5: 138,280,207 (GRCm39) Q24L probably benign Het
Stra6 T C 9: 58,048,380 (GRCm39) Y158H probably damaging Het
Tcstv1a A T 13: 120,355,666 (GRCm39) probably null Het
Tmem196 G A 12: 119,975,002 (GRCm39) C62Y probably damaging Het
Tmem265 T A 7: 127,164,039 (GRCm39) F84L Het
Tph1 C T 7: 46,306,627 (GRCm39) probably null Het
Ttn A G 2: 76,776,834 (GRCm39) I1522T unknown Het
Ulk4 T A 9: 121,084,178 (GRCm39) Q129L probably benign Het
Usp17la T A 7: 104,510,792 (GRCm39) S466T probably benign Het
Vmn2r31 A T 7: 7,387,744 (GRCm39) V609E probably damaging Het
Vmn2r52 C T 7: 9,904,744 (GRCm39) C365Y probably benign Het
Zbtb4 A T 11: 69,666,937 (GRCm39) T81S possibly damaging Het
Zfp605 A T 5: 110,259,885 (GRCm39) probably benign Het
Other mutations in Crocc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Crocc2 APN 1 93,144,766 (GRCm39) nonsense probably null
Popper UTSW 1 93,111,126 (GRCm39) missense possibly damaging 0.81
R0396:Crocc2 UTSW 1 93,151,936 (GRCm39) splice site probably benign
R1382:Crocc2 UTSW 1 93,144,815 (GRCm39) critical splice donor site probably null
R4608:Crocc2 UTSW 1 93,096,516 (GRCm39) missense possibly damaging 0.95
R4609:Crocc2 UTSW 1 93,096,516 (GRCm39) missense possibly damaging 0.95
R4619:Crocc2 UTSW 1 93,141,372 (GRCm39) missense probably benign
R4646:Crocc2 UTSW 1 93,096,516 (GRCm39) missense possibly damaging 0.95
R4647:Crocc2 UTSW 1 93,096,516 (GRCm39) missense possibly damaging 0.95
R4648:Crocc2 UTSW 1 93,096,516 (GRCm39) missense possibly damaging 0.95
R4767:Crocc2 UTSW 1 93,130,578 (GRCm39) missense possibly damaging 0.72
R4811:Crocc2 UTSW 1 93,133,618 (GRCm39) missense probably damaging 0.99
R5046:Crocc2 UTSW 1 93,133,624 (GRCm39) missense probably damaging 0.96
R5389:Crocc2 UTSW 1 93,143,363 (GRCm39) missense probably benign 0.03
R5632:Crocc2 UTSW 1 93,145,575 (GRCm39) missense probably damaging 0.98
R5887:Crocc2 UTSW 1 93,121,838 (GRCm39) missense possibly damaging 0.47
R6128:Crocc2 UTSW 1 93,122,123 (GRCm39) missense probably benign 0.28
R6142:Crocc2 UTSW 1 93,118,201 (GRCm39) missense possibly damaging 0.61
R6258:Crocc2 UTSW 1 93,141,360 (GRCm39) missense possibly damaging 0.57
R6260:Crocc2 UTSW 1 93,141,360 (GRCm39) missense possibly damaging 0.57
R6288:Crocc2 UTSW 1 93,122,227 (GRCm39) missense probably benign 0.07
R6312:Crocc2 UTSW 1 93,143,432 (GRCm39) nonsense probably null
R6335:Crocc2 UTSW 1 93,130,560 (GRCm39) missense probably benign 0.02
R6339:Crocc2 UTSW 1 93,141,754 (GRCm39) missense probably benign 0.23
R6371:Crocc2 UTSW 1 93,143,353 (GRCm39) missense probably benign 0.10
R6439:Crocc2 UTSW 1 93,111,126 (GRCm39) missense possibly damaging 0.81
R6442:Crocc2 UTSW 1 93,112,775 (GRCm39) missense probably benign 0.38
R6545:Crocc2 UTSW 1 93,140,659 (GRCm39) missense probably benign 0.45
R6619:Crocc2 UTSW 1 93,118,223 (GRCm39) missense probably benign 0.09
R6898:Crocc2 UTSW 1 93,143,304 (GRCm39) missense probably benign 0.06
R7170:Crocc2 UTSW 1 93,121,704 (GRCm39) missense possibly damaging 0.95
R7378:Crocc2 UTSW 1 93,121,809 (GRCm39) missense probably damaging 0.98
R7461:Crocc2 UTSW 1 93,122,311 (GRCm39) missense possibly damaging 0.47
R7613:Crocc2 UTSW 1 93,122,311 (GRCm39) missense possibly damaging 0.47
R7831:Crocc2 UTSW 1 93,143,195 (GRCm39) missense probably benign 0.17
R7915:Crocc2 UTSW 1 93,141,363 (GRCm39) missense probably damaging 1.00
R8085:Crocc2 UTSW 1 93,130,578 (GRCm39) missense possibly damaging 0.72
R8171:Crocc2 UTSW 1 93,116,723 (GRCm39) critical splice donor site probably null
R8193:Crocc2 UTSW 1 93,117,888 (GRCm39) splice site probably null
R8494:Crocc2 UTSW 1 93,144,788 (GRCm39) missense probably damaging 1.00
R8856:Crocc2 UTSW 1 93,120,847 (GRCm39) missense probably benign 0.41
R8918:Crocc2 UTSW 1 93,129,144 (GRCm39) missense possibly damaging 0.51
R8970:Crocc2 UTSW 1 93,116,687 (GRCm39) missense probably benign 0.02
R9458:Crocc2 UTSW 1 93,145,516 (GRCm39) missense probably damaging 0.97
R9482:Crocc2 UTSW 1 93,143,106 (GRCm39) missense probably benign 0.32
R9522:Crocc2 UTSW 1 93,117,429 (GRCm39) missense probably benign 0.02
R9597:Crocc2 UTSW 1 93,118,217 (GRCm39) missense probably benign 0.26
R9703:Crocc2 UTSW 1 93,130,444 (GRCm39) missense probably benign
Z1177:Crocc2 UTSW 1 93,154,414 (GRCm39) missense probably benign 0.04
Z1177:Crocc2 UTSW 1 93,141,317 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATATCTAAGTCTGCCTCTACCC -3'
(R):5'- TGTTTGTCACCACAGTGCAG -3'

Sequencing Primer
(F):5'- AAGTCTGCCTCTACCCACATTC -3'
(R):5'- GTCACCACAGTGCAGTTTTAAAAAC -3'
Posted On 2019-09-13