Incidental Mutation 'R7395:Golga2'
ID 573705
Institutional Source Beutler Lab
Gene Symbol Golga2
Ensembl Gene ENSMUSG00000002546
Gene Name golgin A2
Synonyms GM130
MMRRC Submission 045477-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.846) question?
Stock # R7395 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 32178299-32197925 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 32195599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 798 (P798Q)
Ref Sequence ENSEMBL: ENSMUSP00000097768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078352] [ENSMUST00000081670] [ENSMUST00000091089] [ENSMUST00000100194] [ENSMUST00000113350] [ENSMUST00000113352] [ENSMUST00000113365] [ENSMUST00000113377] [ENSMUST00000129156] [ENSMUST00000129193] [ENSMUST00000139624] [ENSMUST00000201433] [ENSMUST00000201440] [ENSMUST00000201494] [ENSMUST00000202578]
AlphaFold Q921M4
Predicted Effect probably benign
Transcript: ENSMUST00000078352
SMART Domains Protein: ENSMUSP00000077461
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081670
AA Change: P728Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080374
Gene: ENSMUSG00000002546
AA Change: P728Q

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 105 173 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Pfam:GOLGA2L5 337 955 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091089
SMART Domains Protein: ENSMUSP00000088618
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 516 623 2.7e-10 SMART
GED 650 741 9.51e-32 SMART
low complexity region 743 757 N/A INTRINSIC
low complexity region 779 812 N/A INTRINSIC
low complexity region 815 826 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100194
AA Change: P798Q

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097768
Gene: ENSMUSG00000002546
AA Change: P798Q

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 98 113 N/A INTRINSIC
coiled coil region 176 244 N/A INTRINSIC
low complexity region 260 273 N/A INTRINSIC
low complexity region 372 384 N/A INTRINSIC
Pfam:GOLGA2L5 408 1026 2.1e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113350
SMART Domains Protein: ENSMUSP00000108977
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113352
SMART Domains Protein: ENSMUSP00000108979
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113365
SMART Domains Protein: ENSMUSP00000108992
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113377
AA Change: P771Q

PolyPhen 2 Score 0.639 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109004
Gene: ENSMUSG00000002546
AA Change: P771Q

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
low complexity region 45 51 N/A INTRINSIC
low complexity region 71 86 N/A INTRINSIC
coiled coil region 149 217 N/A INTRINSIC
low complexity region 233 246 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:GOLGA2L5 381 999 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129156
SMART Domains Protein: ENSMUSP00000118914
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
PH 1 96 2.75e-2 SMART
GED 123 214 9.51e-32 SMART
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 258 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129193
SMART Domains Protein: ENSMUSP00000115003
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
coiled coil region 136 176 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
coiled coil region 226 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131712
SMART Domains Protein: ENSMUSP00000114169
Gene: ENSMUSG00000002546

DomainStartEndE-ValueType
low complexity region 33 39 N/A INTRINSIC
coiled coil region 106 146 N/A INTRINSIC
low complexity region 162 175 N/A INTRINSIC
coiled coil region 196 331 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139291
SMART Domains Protein: ENSMUSP00000115523
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:GED 1 43 3.3e-7 PFAM
low complexity region 45 59 N/A INTRINSIC
low complexity region 81 114 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139624
SMART Domains Protein: ENSMUSP00000122679
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155269
SMART Domains Protein: ENSMUSP00000116054
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
GED 1 53 1.63e-1 SMART
low complexity region 55 69 N/A INTRINSIC
low complexity region 91 124 N/A INTRINSIC
low complexity region 127 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201433
SMART Domains Protein: ENSMUSP00000144264
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
low complexity region 851 861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201440
SMART Domains Protein: ENSMUSP00000144309
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
Pfam:GED 1 41 5.9e-7 PFAM
low complexity region 43 57 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201494
SMART Domains Protein: ENSMUSP00000144145
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 6.9e-180 SMART
Pfam:Dynamin_M 413 473 2.1e-14 PFAM
PH 491 598 1.2e-12 SMART
GED 625 716 6.1e-34 SMART
low complexity region 718 732 N/A INTRINSIC
low complexity region 754 787 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 822 832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202578
SMART Domains Protein: ENSMUSP00000143955
Gene: ENSMUSG00000026825

DomainStartEndE-ValueType
DYNc 6 245 1.38e-177 SMART
PH 520 627 2.7e-10 SMART
GED 654 745 9.51e-32 SMART
low complexity region 747 761 N/A INTRINSIC
low complexity region 783 816 N/A INTRINSIC
low complexity region 819 830 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Golgi apparatus, which participates in glycosylation and transport of proteins and lipids in the secretory pathway, consists of a series of stacked cisternae (flattened membrane sacs). Interactions between the Golgi and microtubules are thought to be important for the reorganization of the Golgi after it fragments during mitosis. This gene encodes one of the golgins, a family of proteins localized to the Golgi. This encoded protein has been postulated to play roles in the stacking of Golgi cisternae and in vesicular transport. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of these variants has not been determined. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 55,184,140 (GRCm39) probably null Het
4930433I11Rik A T 7: 40,639,102 (GRCm39) T13S probably damaging Het
Abca13 A G 11: 9,241,658 (GRCm39) I1174V probably benign Het
Acoxl G A 2: 127,726,336 (GRCm39) V237M probably damaging Het
Adam33 A C 2: 130,903,089 (GRCm39) W52G probably benign Het
Adgrv1 T C 13: 81,707,467 (GRCm39) H1313R probably damaging Het
Ap3d1 T C 10: 80,566,716 (GRCm39) T89A probably benign Het
Armc8 T C 9: 99,415,185 (GRCm39) E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,949 (GRCm39) *383Q probably null Het
Atp8b4 A T 2: 126,217,614 (GRCm39) L634Q possibly damaging Het
B3glct A G 5: 149,649,069 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Bicd2 A G 13: 49,531,706 (GRCm39) D316G possibly damaging Het
Bop1 A T 15: 76,338,041 (GRCm39) S610T probably damaging Het
Car11 T A 7: 45,350,745 (GRCm39) Y80* probably null Het
Ccdc121rt2 A T 5: 112,598,035 (GRCm39) E194V possibly damaging Het
Ccdc96 T C 5: 36,642,609 (GRCm39) I205T probably benign Het
Ces2a A G 8: 105,466,273 (GRCm39) E390G probably benign Het
Cfap54 C A 10: 92,720,565 (GRCm39) V2630L unknown Het
Chek2 G T 5: 111,019,974 (GRCm39) probably null Het
Cntn3 C T 6: 102,314,355 (GRCm39) probably null Het
Cpne3 A T 4: 19,528,239 (GRCm39) D339E probably damaging Het
Crocc2 C T 1: 93,143,829 (GRCm39) Q1403* probably null Het
Crppa A T 12: 36,551,994 (GRCm39) I283F possibly damaging Het
Csnka2ip G A 16: 64,299,803 (GRCm39) T187I Het
Ctu1 A G 7: 43,326,019 (GRCm39) H226R possibly damaging Het
Cubn G T 2: 13,291,875 (GRCm39) Q3317K probably damaging Het
Cyp17a1 A G 19: 46,659,134 (GRCm39) L169P probably benign Het
Dcc T A 18: 71,507,640 (GRCm39) K911* probably null Het
Dcun1d2 G A 8: 13,328,675 (GRCm39) R75* probably null Het
Defb19 A T 2: 152,421,943 (GRCm39) probably null Het
Dffb A T 4: 154,053,570 (GRCm39) S257R probably damaging Het
Dip2c A C 13: 9,664,413 (GRCm39) N942T probably damaging Het
Dnah3 T A 7: 119,565,474 (GRCm39) I169F Het
Dnah3 T C 7: 119,660,183 (GRCm39) M830V probably benign Het
Dnajc5g G A 5: 31,269,009 (GRCm39) S130N possibly damaging Het
Dscaml1 C A 9: 45,613,703 (GRCm39) Q939K possibly damaging Het
Evpl G C 11: 116,117,905 (GRCm39) N761K possibly damaging Het
Fbxw8 A T 5: 118,206,280 (GRCm39) I556N probably damaging Het
Fry G T 5: 150,304,348 (GRCm39) M579I possibly damaging Het
Ggt7 A T 2: 155,337,800 (GRCm39) M488K probably benign Het
Gnpnat1 T A 14: 45,619,038 (GRCm39) H107L probably benign Het
Gpr35 G A 1: 92,910,929 (GRCm39) A214T probably damaging Het
Greb1 A T 12: 16,759,431 (GRCm39) probably null Het
Hdac10 G A 15: 89,012,487 (GRCm39) T32I probably benign Het
Hkdc1 G A 10: 62,221,478 (GRCm39) T860I probably damaging Het
Icam5 C A 9: 20,946,738 (GRCm39) P422Q possibly damaging Het
Ist1 A C 8: 110,404,159 (GRCm39) S238A probably benign Het
Lrig2 T C 3: 104,404,836 (GRCm39) N91D probably benign Het
Mapt A C 11: 104,218,949 (GRCm39) D352A probably damaging Het
Micall2 G A 5: 139,702,124 (GRCm39) P373L possibly damaging Het
Mocs1 A G 17: 49,761,585 (GRCm39) S560G possibly damaging Het
Mpo A G 11: 87,691,950 (GRCm39) D461G probably damaging Het
Myo1a G T 10: 127,546,309 (GRCm39) V271L probably damaging Het
Ncoa1 G A 12: 4,345,188 (GRCm39) P720S not run Het
Ncr1 T A 7: 4,341,150 (GRCm39) I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 (GRCm39) R66C probably damaging Het
Obox5 A T 7: 15,492,668 (GRCm39) S208C probably damaging Het
Or10q1 T C 19: 13,726,502 (GRCm39) S11P probably damaging Het
Or2n1d A T 17: 38,646,755 (GRCm39) K236* probably null Het
Or5p75-ps1 T A 7: 108,107,611 (GRCm39) F116Y unknown Het
Or7d9 T A 9: 20,197,826 (GRCm39) M285K probably damaging Het
Padi4 A C 4: 140,488,983 (GRCm39) V152G probably damaging Het
Pdzd7 A T 19: 45,025,450 (GRCm39) D348E probably damaging Het
Pdzph1 T A 17: 59,186,154 (GRCm39) K1212N possibly damaging Het
Piezo2 C T 18: 63,160,634 (GRCm39) G2341R probably damaging Het
Plb1 A G 5: 32,511,028 (GRCm39) K1298E probably benign Het
Prr14l A G 5: 32,985,982 (GRCm39) L1171P probably benign Het
Rab11fip5 T C 6: 85,318,850 (GRCm39) T680A probably benign Het
Rev1 A T 1: 38,127,146 (GRCm39) N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Ryr2 A G 13: 11,799,997 (GRCm39) C917R probably damaging Het
Sall1 A T 8: 89,757,549 (GRCm39) S852T possibly damaging Het
Serpine2 A G 1: 79,779,272 (GRCm39) F296L probably damaging Het
Slc12a6 A T 2: 112,182,887 (GRCm39) N754I probably damaging Het
Slc39a6 A T 18: 24,718,332 (GRCm39) L575Q probably damaging Het
Smarcc2 T A 10: 128,321,475 (GRCm39) L890Q probably damaging Het
Smg5 T A 3: 88,268,378 (GRCm39) V1006D probably damaging Het
Ssh2 T C 11: 77,283,899 (GRCm39) V51A probably damaging Het
St14 T C 9: 31,008,195 (GRCm39) K547E probably benign Het
Stag1 T G 9: 100,678,781 (GRCm39) V234G probably damaging Het
Stag3 A T 5: 138,280,207 (GRCm39) Q24L probably benign Het
Stra6 T C 9: 58,048,380 (GRCm39) Y158H probably damaging Het
Tcstv1a A T 13: 120,355,666 (GRCm39) probably null Het
Tmem196 G A 12: 119,975,002 (GRCm39) C62Y probably damaging Het
Tmem265 T A 7: 127,164,039 (GRCm39) F84L Het
Tph1 C T 7: 46,306,627 (GRCm39) probably null Het
Ttn A G 2: 76,776,834 (GRCm39) I1522T unknown Het
Ulk4 T A 9: 121,084,178 (GRCm39) Q129L probably benign Het
Usp17la T A 7: 104,510,792 (GRCm39) S466T probably benign Het
Vmn2r31 A T 7: 7,387,744 (GRCm39) V609E probably damaging Het
Vmn2r52 C T 7: 9,904,744 (GRCm39) C365Y probably benign Het
Zbtb4 A T 11: 69,666,937 (GRCm39) T81S possibly damaging Het
Zfp605 A T 5: 110,259,885 (GRCm39) probably benign Het
Other mutations in Golga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00531:Golga2 APN 2 32,195,226 (GRCm39) missense probably benign 0.01
IGL01561:Golga2 APN 2 32,186,689 (GRCm39) missense probably benign 0.00
IGL02396:Golga2 APN 2 32,188,656 (GRCm39) splice site probably benign
IGL02636:Golga2 APN 2 32,186,735 (GRCm39) critical splice donor site probably null
IGL02712:Golga2 APN 2 32,194,225 (GRCm39) missense probably damaging 1.00
IGL03172:Golga2 APN 2 32,182,168 (GRCm39) missense probably benign 0.04
IGL03193:Golga2 APN 2 32,195,020 (GRCm39) missense probably damaging 1.00
little UTSW 2 32,195,996 (GRCm39) nonsense probably null
R0050:Golga2 UTSW 2 32,182,139 (GRCm39) missense probably damaging 0.96
R0050:Golga2 UTSW 2 32,182,139 (GRCm39) missense probably damaging 0.96
R0265:Golga2 UTSW 2 32,194,964 (GRCm39) splice site probably null
R0440:Golga2 UTSW 2 32,192,945 (GRCm39) missense probably damaging 1.00
R0644:Golga2 UTSW 2 32,187,533 (GRCm39) missense probably damaging 1.00
R0825:Golga2 UTSW 2 32,194,803 (GRCm39) missense probably damaging 1.00
R1179:Golga2 UTSW 2 32,193,707 (GRCm39) missense possibly damaging 0.50
R1447:Golga2 UTSW 2 32,187,788 (GRCm39) missense possibly damaging 0.69
R1459:Golga2 UTSW 2 32,187,807 (GRCm39) splice site probably null
R1517:Golga2 UTSW 2 32,195,996 (GRCm39) nonsense probably null
R1522:Golga2 UTSW 2 32,192,216 (GRCm39) missense probably benign 0.01
R1599:Golga2 UTSW 2 32,193,185 (GRCm39) missense probably benign 0.00
R1702:Golga2 UTSW 2 32,189,287 (GRCm39) missense probably damaging 1.00
R1716:Golga2 UTSW 2 32,192,909 (GRCm39) missense probably damaging 1.00
R1777:Golga2 UTSW 2 32,195,482 (GRCm39) splice site probably null
R1781:Golga2 UTSW 2 32,196,588 (GRCm39) missense probably damaging 1.00
R2229:Golga2 UTSW 2 32,196,477 (GRCm39) missense probably benign 0.06
R2484:Golga2 UTSW 2 32,194,782 (GRCm39) missense probably benign 0.32
R2972:Golga2 UTSW 2 32,195,671 (GRCm39) missense probably benign 0.16
R3411:Golga2 UTSW 2 32,192,954 (GRCm39) missense probably damaging 0.98
R3851:Golga2 UTSW 2 32,195,623 (GRCm39) missense probably benign 0.30
R3852:Golga2 UTSW 2 32,195,623 (GRCm39) missense probably benign 0.30
R4130:Golga2 UTSW 2 32,178,178 (GRCm39) missense probably benign 0.07
R4783:Golga2 UTSW 2 32,187,168 (GRCm39) missense probably damaging 1.00
R4784:Golga2 UTSW 2 32,187,168 (GRCm39) missense probably damaging 1.00
R4785:Golga2 UTSW 2 32,187,168 (GRCm39) missense probably damaging 1.00
R4808:Golga2 UTSW 2 32,193,226 (GRCm39) missense probably benign 0.00
R5103:Golga2 UTSW 2 32,193,758 (GRCm39) missense probably benign 0.09
R5261:Golga2 UTSW 2 32,194,166 (GRCm39) missense probably benign 0.02
R5315:Golga2 UTSW 2 32,193,773 (GRCm39) missense probably damaging 1.00
R5508:Golga2 UTSW 2 32,178,199 (GRCm39) nonsense probably null
R5627:Golga2 UTSW 2 32,196,059 (GRCm39) nonsense probably null
R5921:Golga2 UTSW 2 32,187,767 (GRCm39) missense probably benign 0.00
R6678:Golga2 UTSW 2 32,189,072 (GRCm39) missense probably damaging 0.99
R7365:Golga2 UTSW 2 32,193,013 (GRCm39) nonsense probably null
R7390:Golga2 UTSW 2 32,178,202 (GRCm39) missense
R7555:Golga2 UTSW 2 32,178,178 (GRCm39) missense probably benign 0.07
R7640:Golga2 UTSW 2 32,196,251 (GRCm39) missense probably benign
R8219:Golga2 UTSW 2 32,196,492 (GRCm39) missense probably damaging 1.00
R8554:Golga2 UTSW 2 32,183,357 (GRCm39) missense probably damaging 1.00
R9071:Golga2 UTSW 2 32,178,364 (GRCm39) missense probably damaging 1.00
R9127:Golga2 UTSW 2 32,196,079 (GRCm39) missense
R9214:Golga2 UTSW 2 32,195,822 (GRCm39) missense probably damaging 1.00
R9537:Golga2 UTSW 2 32,178,313 (GRCm39) unclassified probably benign
R9643:Golga2 UTSW 2 32,193,874 (GRCm39) missense probably damaging 0.97
R9716:Golga2 UTSW 2 32,189,287 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCACTTTGTGCCTGGAAG -3'
(R):5'- ATGCAGCAATGTTCAAGCTC -3'

Sequencing Primer
(F):5'- TGGAAGCCAGTGGTCAGTCTC -3'
(R):5'- TCCTGCATGACCTCCAGGAAG -3'
Posted On 2019-09-13