Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Slc12a6'

573707

Institutional Source

Beutler Lab

Gene Symbol

Slc12a6

Ensembl Gene

ENSMUSG00000027130

Gene Name

solute carrier family 12, member 6

Synonyms

gaxp, KCC3

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.171) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112265825-112363163 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 112352542 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 754 (N754I)

Ref Sequence

ENSEMBL: ENSMUSP00000028549 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]

AlphaFold

Q924N4

Predicted Effect

probably damaging
Transcript: ENSMUST00000028549
AA Change: N754I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: N754I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	8e-3	SMART
Pfam:AA_permease	190	384	4.1e-25	PFAM
Pfam:AA_permease	453	761	2.3e-43	PFAM
Pfam:SLC12	773	897	7.1e-20	PFAM
Pfam:SLC12	892	1150	3.9e-32	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000053666
AA Change: N703I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130
AA Change: N703I

Domain	Start	End	E-Value	Type
Pfam:AA_permease	139	333	2.3e-25	PFAM
Pfam:AA_permease_2	385	668	1.5e-19	PFAM
Pfam:AA_permease	391	710	4.5e-41	PFAM
low complexity region	828	842	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	967	996	2.2e-23	PFAM
low complexity region	1079	1091	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110987
AA Change: N739I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: N739I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	4e-3	SMART
Pfam:AA_permease	175	369	3.9e-25	PFAM
Pfam:AA_permease_2	421	704	3.2e-19	PFAM
Pfam:AA_permease	426	746	5.8e-41	PFAM
low complexity region	864	878	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110991
AA Change: N754I

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: N754I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	114	171	7e-3	SMART
Pfam:AA_permease	190	384	4.2e-25	PFAM
Pfam:AA_permease_2	436	719	2.9e-19	PFAM
Pfam:AA_permease	442	761	8.2e-41	PFAM
low complexity region	879	893	N/A	INTRINSIC
Pfam:KCl_Cotrans_1	1018	1047	2.7e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000141047
AA Change: N739I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: N739I

Domain	Start	End	E-Value	Type
low complexity region	28	53	N/A	INTRINSIC
SCOP:d1qqea_	99	156	8e-3	SMART
Pfam:AA_permease	175	369	6.6e-25	PFAM
Pfam:AA_permease	438	746	3.6e-43	PFAM
Pfam:SLC12	758	884	6.8e-20	PFAM
Pfam:SLC12	877	1033	5.9e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Slc12a6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01488:Slc12a6	APN	2	112353064	splice site	probably null
IGL02573:Slc12a6	APN	2	112358641	critical splice donor site	probably null
burgess	UTSW	2	112347317	missense	probably benign	0.09
petrified_forest	UTSW	2	112347426	missense	probably damaging	1.00
Prebiotic	UTSW	2	112352935	missense	probably benign	0.30
R0548:Slc12a6	UTSW	2	112335924	critical splice donor site	probably null
R1495:Slc12a6	UTSW	2	112354190	missense	probably damaging	0.99
R1726:Slc12a6	UTSW	2	112347426	missense	probably damaging	1.00
R1856:Slc12a6	UTSW	2	112335927	splice site	probably null
R1958:Slc12a6	UTSW	2	112355158	missense	possibly damaging	0.92
R2112:Slc12a6	UTSW	2	112356485	missense	probably damaging	1.00
R2865:Slc12a6	UTSW	2	112347317	missense	probably benign	0.09
R3888:Slc12a6	UTSW	2	112267030	missense	possibly damaging	0.76
R4412:Slc12a6	UTSW	2	112335888	missense	possibly damaging	0.95
R4655:Slc12a6	UTSW	2	112357766	critical splice acceptor site	probably null
R4669:Slc12a6	UTSW	2	112354295	missense	probably damaging	1.00
R4928:Slc12a6	UTSW	2	112352961	missense	probably damaging	1.00
R4974:Slc12a6	UTSW	2	112358525	missense	probably damaging	1.00
R5016:Slc12a6	UTSW	2	112356627	intron	probably benign
R5372:Slc12a6	UTSW	2	112347360	nonsense	probably null
R5405:Slc12a6	UTSW	2	112339379	missense	probably damaging	1.00
R5786:Slc12a6	UTSW	2	112284722	missense	probably benign	0.01
R5836:Slc12a6	UTSW	2	112341998	missense	possibly damaging	0.62
R6280:Slc12a6	UTSW	2	112337358	missense	probably damaging	1.00
R6310:Slc12a6	UTSW	2	112335839	missense	probably damaging	1.00
R6525:Slc12a6	UTSW	2	112352451	missense	probably damaging	1.00
R6597:Slc12a6	UTSW	2	112352935	missense	probably damaging	1.00
R6723:Slc12a6	UTSW	2	112337942	missense	probably damaging	1.00
R6895:Slc12a6	UTSW	2	112355095	missense	probably damaging	1.00
R7059:Slc12a6	UTSW	2	112352912	missense	probably damaging	0.99
R7188:Slc12a6	UTSW	2	112334415	missense	probably benign	0.04
R7552:Slc12a6	UTSW	2	112341974	missense	probably damaging	1.00
R7992:Slc12a6	UTSW	2	112335911	missense	probably damaging	1.00
R8016:Slc12a6	UTSW	2	112356554	missense	probably benign	0.42
R8122:Slc12a6	UTSW	2	112266822	start codon destroyed	probably null
R8192:Slc12a6	UTSW	2	112351377	missense	probably damaging	1.00
R8222:Slc12a6	UTSW	2	112339525	splice site	probably null
R8534:Slc12a6	UTSW	2	112343967	missense	probably damaging	1.00
R9018:Slc12a6	UTSW	2	112344240	splice site	probably benign
R9281:Slc12a6	UTSW	2	112334409	missense	probably benign	0.00
R9418:Slc12a6	UTSW	2	112344210	missense
R9448:Slc12a6	UTSW	2	112349359	missense	probably damaging	1.00
R9460:Slc12a6	UTSW	2	112352935	missense	probably benign	0.30
R9694:Slc12a6	UTSW	2	112344536	missense	probably damaging	1.00
R9712:Slc12a6	UTSW	2	112356472	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTAGATTTAGAGAATCCTGGG -3'
(R):5'- AGGAGGGCCACAAAGCATTC -3'

Sequencing Primer
(F):5'- TTTTTCTCCCAAGGGCTG -3'
(R):5'- GCATTCAACTTTGACAGAAGAATGG -3'

Posted On

2019-09-13