Incidental Mutation 'R7395:Adam33'
ID 573710
Institutional Source Beutler Lab
Gene Symbol Adam33
Ensembl Gene ENSMUSG00000027318
Gene Name a disintegrin and metallopeptidase domain 33
Synonyms
MMRRC Submission 045477-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7395 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130892739-130905734 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 130903089 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Glycine at position 52 (W52G)
Ref Sequence ENSEMBL: ENSMUSP00000105861 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052104] [ENSMUST00000110232] [ENSMUST00000183552]
AlphaFold Q923W9
Predicted Effect probably benign
Transcript: ENSMUST00000052104
AA Change: W52G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000052486
Gene: ENSMUSG00000027318
AA Change: W52G

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 1.9e-28 PFAM
Pfam:Reprolysin_5 209 390 6.9e-21 PFAM
Pfam:Reprolysin_4 209 401 3.5e-9 PFAM
Pfam:Reprolysin 211 410 1.9e-60 PFAM
Pfam:Reprolysin_2 232 400 3e-14 PFAM
Pfam:Reprolysin_3 235 357 1.2e-16 PFAM
DISIN 427 502 8.4e-42 SMART
ACR 503 647 6.8e-51 SMART
transmembrane domain 677 699 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110232
AA Change: W52G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000105861
Gene: ENSMUSG00000027318
AA Change: W52G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 36 168 1.3e-24 PFAM
Pfam:Reprolysin_5 209 390 8.5e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 4e-63 PFAM
Pfam:Reprolysin_2 231 400 7.3e-17 PFAM
Pfam:Reprolysin_3 235 357 2.2e-20 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135149
SMART Domains Protein: ENSMUSP00000122608
Gene: ENSMUSG00000027318

DomainStartEndE-ValueType
Pfam:Reprolysin_5 68 249 1.8e-23 PFAM
Pfam:Reprolysin_4 68 260 8.6e-12 PFAM
Pfam:Reprolysin 70 269 8.3e-64 PFAM
Pfam:Reprolysin_2 90 259 1.5e-17 PFAM
Pfam:Reprolysin_3 94 216 5.1e-21 PFAM
DISIN 286 361 1.66e-39 SMART
ACR 362 505 8.02e-44 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117097
Gene: ENSMUSG00000027318
AA Change: W51G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 74 92 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183552
AA Change: W52G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139344
Gene: ENSMUSG00000027318
AA Change: W52G

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:Pep_M12B_propep 38 168 2.4e-30 PFAM
Pfam:Reprolysin_5 209 390 8.2e-23 PFAM
Pfam:Reprolysin_4 209 401 4.2e-11 PFAM
Pfam:Reprolysin 211 410 2.4e-62 PFAM
Pfam:Reprolysin_2 232 400 2.8e-16 PFAM
Pfam:Reprolysin_3 235 357 1.5e-18 PFAM
DISIN 427 502 1.66e-39 SMART
ACR 503 646 7.59e-54 SMART
EGF 653 682 1.53e-1 SMART
transmembrane domain 703 725 N/A INTRINSIC
Meta Mutation Damage Score 0.2154 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is widely expressed, most highly in the adult brain, heart, kidney, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a targeted gene deletion are viable, fertile, developmentally normal and display normal allergen-induced airway hyperreactivity, IgE production, mucus metaplasia, and airway inflammation in an OVA-induced model of allergic asthma. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 55,184,140 (GRCm39) probably null Het
4930433I11Rik A T 7: 40,639,102 (GRCm39) T13S probably damaging Het
Abca13 A G 11: 9,241,658 (GRCm39) I1174V probably benign Het
Acoxl G A 2: 127,726,336 (GRCm39) V237M probably damaging Het
Adgrv1 T C 13: 81,707,467 (GRCm39) H1313R probably damaging Het
Ap3d1 T C 10: 80,566,716 (GRCm39) T89A probably benign Het
Armc8 T C 9: 99,415,185 (GRCm39) E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,949 (GRCm39) *383Q probably null Het
Atp8b4 A T 2: 126,217,614 (GRCm39) L634Q possibly damaging Het
B3glct A G 5: 149,649,069 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Bicd2 A G 13: 49,531,706 (GRCm39) D316G possibly damaging Het
Bop1 A T 15: 76,338,041 (GRCm39) S610T probably damaging Het
Car11 T A 7: 45,350,745 (GRCm39) Y80* probably null Het
Ccdc121rt2 A T 5: 112,598,035 (GRCm39) E194V possibly damaging Het
Ccdc96 T C 5: 36,642,609 (GRCm39) I205T probably benign Het
Ces2a A G 8: 105,466,273 (GRCm39) E390G probably benign Het
Cfap54 C A 10: 92,720,565 (GRCm39) V2630L unknown Het
Chek2 G T 5: 111,019,974 (GRCm39) probably null Het
Cntn3 C T 6: 102,314,355 (GRCm39) probably null Het
Cpne3 A T 4: 19,528,239 (GRCm39) D339E probably damaging Het
Crocc2 C T 1: 93,143,829 (GRCm39) Q1403* probably null Het
Crppa A T 12: 36,551,994 (GRCm39) I283F possibly damaging Het
Csnka2ip G A 16: 64,299,803 (GRCm39) T187I Het
Ctu1 A G 7: 43,326,019 (GRCm39) H226R possibly damaging Het
Cubn G T 2: 13,291,875 (GRCm39) Q3317K probably damaging Het
Cyp17a1 A G 19: 46,659,134 (GRCm39) L169P probably benign Het
Dcc T A 18: 71,507,640 (GRCm39) K911* probably null Het
Dcun1d2 G A 8: 13,328,675 (GRCm39) R75* probably null Het
Defb19 A T 2: 152,421,943 (GRCm39) probably null Het
Dffb A T 4: 154,053,570 (GRCm39) S257R probably damaging Het
Dip2c A C 13: 9,664,413 (GRCm39) N942T probably damaging Het
Dnah3 T A 7: 119,565,474 (GRCm39) I169F Het
Dnah3 T C 7: 119,660,183 (GRCm39) M830V probably benign Het
Dnajc5g G A 5: 31,269,009 (GRCm39) S130N possibly damaging Het
Dscaml1 C A 9: 45,613,703 (GRCm39) Q939K possibly damaging Het
Evpl G C 11: 116,117,905 (GRCm39) N761K possibly damaging Het
Fbxw8 A T 5: 118,206,280 (GRCm39) I556N probably damaging Het
Fry G T 5: 150,304,348 (GRCm39) M579I possibly damaging Het
Ggt7 A T 2: 155,337,800 (GRCm39) M488K probably benign Het
Gnpnat1 T A 14: 45,619,038 (GRCm39) H107L probably benign Het
Golga2 C A 2: 32,195,599 (GRCm39) P798Q possibly damaging Het
Gpr35 G A 1: 92,910,929 (GRCm39) A214T probably damaging Het
Greb1 A T 12: 16,759,431 (GRCm39) probably null Het
Hdac10 G A 15: 89,012,487 (GRCm39) T32I probably benign Het
Hkdc1 G A 10: 62,221,478 (GRCm39) T860I probably damaging Het
Icam5 C A 9: 20,946,738 (GRCm39) P422Q possibly damaging Het
Ist1 A C 8: 110,404,159 (GRCm39) S238A probably benign Het
Lrig2 T C 3: 104,404,836 (GRCm39) N91D probably benign Het
Mapt A C 11: 104,218,949 (GRCm39) D352A probably damaging Het
Micall2 G A 5: 139,702,124 (GRCm39) P373L possibly damaging Het
Mocs1 A G 17: 49,761,585 (GRCm39) S560G possibly damaging Het
Mpo A G 11: 87,691,950 (GRCm39) D461G probably damaging Het
Myo1a G T 10: 127,546,309 (GRCm39) V271L probably damaging Het
Ncoa1 G A 12: 4,345,188 (GRCm39) P720S not run Het
Ncr1 T A 7: 4,341,150 (GRCm39) I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 (GRCm39) R66C probably damaging Het
Obox5 A T 7: 15,492,668 (GRCm39) S208C probably damaging Het
Or10q1 T C 19: 13,726,502 (GRCm39) S11P probably damaging Het
Or2n1d A T 17: 38,646,755 (GRCm39) K236* probably null Het
Or5p75-ps1 T A 7: 108,107,611 (GRCm39) F116Y unknown Het
Or7d9 T A 9: 20,197,826 (GRCm39) M285K probably damaging Het
Padi4 A C 4: 140,488,983 (GRCm39) V152G probably damaging Het
Pdzd7 A T 19: 45,025,450 (GRCm39) D348E probably damaging Het
Pdzph1 T A 17: 59,186,154 (GRCm39) K1212N possibly damaging Het
Piezo2 C T 18: 63,160,634 (GRCm39) G2341R probably damaging Het
Plb1 A G 5: 32,511,028 (GRCm39) K1298E probably benign Het
Prr14l A G 5: 32,985,982 (GRCm39) L1171P probably benign Het
Rab11fip5 T C 6: 85,318,850 (GRCm39) T680A probably benign Het
Rev1 A T 1: 38,127,146 (GRCm39) N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Ryr2 A G 13: 11,799,997 (GRCm39) C917R probably damaging Het
Sall1 A T 8: 89,757,549 (GRCm39) S852T possibly damaging Het
Serpine2 A G 1: 79,779,272 (GRCm39) F296L probably damaging Het
Slc12a6 A T 2: 112,182,887 (GRCm39) N754I probably damaging Het
Slc39a6 A T 18: 24,718,332 (GRCm39) L575Q probably damaging Het
Smarcc2 T A 10: 128,321,475 (GRCm39) L890Q probably damaging Het
Smg5 T A 3: 88,268,378 (GRCm39) V1006D probably damaging Het
Ssh2 T C 11: 77,283,899 (GRCm39) V51A probably damaging Het
St14 T C 9: 31,008,195 (GRCm39) K547E probably benign Het
Stag1 T G 9: 100,678,781 (GRCm39) V234G probably damaging Het
Stag3 A T 5: 138,280,207 (GRCm39) Q24L probably benign Het
Stra6 T C 9: 58,048,380 (GRCm39) Y158H probably damaging Het
Tcstv1a A T 13: 120,355,666 (GRCm39) probably null Het
Tmem196 G A 12: 119,975,002 (GRCm39) C62Y probably damaging Het
Tmem265 T A 7: 127,164,039 (GRCm39) F84L Het
Tph1 C T 7: 46,306,627 (GRCm39) probably null Het
Ttn A G 2: 76,776,834 (GRCm39) I1522T unknown Het
Ulk4 T A 9: 121,084,178 (GRCm39) Q129L probably benign Het
Usp17la T A 7: 104,510,792 (GRCm39) S466T probably benign Het
Vmn2r31 A T 7: 7,387,744 (GRCm39) V609E probably damaging Het
Vmn2r52 C T 7: 9,904,744 (GRCm39) C365Y probably benign Het
Zbtb4 A T 11: 69,666,937 (GRCm39) T81S possibly damaging Het
Zfp605 A T 5: 110,259,885 (GRCm39) probably benign Het
Other mutations in Adam33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Adam33 APN 2 130,896,183 (GRCm39) splice site probably benign
IGL01586:Adam33 APN 2 130,895,970 (GRCm39) missense probably damaging 1.00
IGL02156:Adam33 APN 2 130,895,078 (GRCm39) splice site probably benign
IGL02498:Adam33 APN 2 130,895,157 (GRCm39) missense probably damaging 1.00
3-1:Adam33 UTSW 2 130,896,041 (GRCm39) splice site probably null
R0012:Adam33 UTSW 2 130,894,840 (GRCm39) missense probably damaging 1.00
R0471:Adam33 UTSW 2 130,896,399 (GRCm39) missense probably damaging 0.99
R1401:Adam33 UTSW 2 130,893,391 (GRCm39) unclassified probably benign
R2071:Adam33 UTSW 2 130,897,266 (GRCm39) missense probably benign 0.01
R2095:Adam33 UTSW 2 130,895,629 (GRCm39) missense probably damaging 1.00
R2383:Adam33 UTSW 2 130,893,282 (GRCm39) missense probably benign 0.01
R4077:Adam33 UTSW 2 130,905,444 (GRCm39) utr 5 prime probably benign
R4403:Adam33 UTSW 2 130,895,190 (GRCm39) missense probably benign 0.03
R4821:Adam33 UTSW 2 130,903,115 (GRCm39) missense probably benign 0.03
R5110:Adam33 UTSW 2 130,895,690 (GRCm39) missense probably damaging 1.00
R5150:Adam33 UTSW 2 130,895,117 (GRCm39) intron probably benign
R5364:Adam33 UTSW 2 130,896,392 (GRCm39) critical splice donor site probably null
R5632:Adam33 UTSW 2 130,895,362 (GRCm39) missense probably damaging 1.00
R5818:Adam33 UTSW 2 130,896,278 (GRCm39) missense possibly damaging 0.51
R6226:Adam33 UTSW 2 130,897,530 (GRCm39) missense probably damaging 1.00
R6478:Adam33 UTSW 2 130,893,266 (GRCm39) missense probably benign 0.01
R6755:Adam33 UTSW 2 130,895,069 (GRCm39) missense probably damaging 1.00
R7230:Adam33 UTSW 2 130,895,483 (GRCm39) missense probably damaging 1.00
R7322:Adam33 UTSW 2 130,895,614 (GRCm39) missense probably damaging 1.00
R7650:Adam33 UTSW 2 130,903,067 (GRCm39) missense probably damaging 1.00
R7783:Adam33 UTSW 2 130,900,257 (GRCm39) missense unknown
R7809:Adam33 UTSW 2 130,893,266 (GRCm39) missense probably benign
R7932:Adam33 UTSW 2 130,905,617 (GRCm39) unclassified probably benign
R8210:Adam33 UTSW 2 130,898,250 (GRCm39) missense probably benign
R8969:Adam33 UTSW 2 130,894,994 (GRCm39) missense probably damaging 1.00
R9102:Adam33 UTSW 2 130,897,737 (GRCm39) missense probably benign 0.01
R9449:Adam33 UTSW 2 130,895,606 (GRCm39) missense possibly damaging 0.47
R9650:Adam33 UTSW 2 130,894,989 (GRCm39) missense possibly damaging 0.48
R9720:Adam33 UTSW 2 130,900,236 (GRCm39) missense
Z1177:Adam33 UTSW 2 130,900,582 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGCCTCACGCCATCTAGATG -3'
(R):5'- GCCGCTTCAAATTCCCCAATG -3'

Sequencing Primer
(F):5'- ACGCCATCTAGATGTCTCTTTG -3'
(R):5'- CCAATGGGGATGGTTCCTG -3'
Posted On 2019-09-13