Incidental Mutation 'R7395:Smg5'
ID573712
Institutional Source Beutler Lab
Gene Symbol Smg5
Ensembl Gene ENSMUSG00000001415
Gene NameSmg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7395 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88336260-88362338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88361071 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1006 (V1006D)
Ref Sequence ENSEMBL: ENSMUSP00000001451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001451] [ENSMUST00000147948] [ENSMUST00000147991]
Predicted Effect probably damaging
Transcript: ENSMUST00000001451
AA Change: V1006D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001451
Gene: ENSMUSG00000001415
AA Change: V1006D

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
Pfam:EST1 77 189 1.1e-26 PFAM
Pfam:EST1_DNA_bind 197 427 4.6e-53 PFAM
low complexity region 447 468 N/A INTRINSIC
low complexity region 481 501 N/A INTRINSIC
Pfam:EST1_DNA_bind 611 745 3.7e-9 PFAM
coiled coil region 801 842 N/A INTRINSIC
PINc 856 979 3.23e-15 SMART
low complexity region 990 999 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147948
SMART Domains Protein: ENSMUSP00000119656
Gene: ENSMUSG00000041423

DomainStartEndE-ValueType
Pfam:HlyIII 59 161 6.8e-18 PFAM
transmembrane domain 180 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147991
SMART Domains Protein: ENSMUSP00000114166
Gene: ENSMUSG00000041423

DomainStartEndE-ValueType
Pfam:HlyIII 43 271 5.5e-51 PFAM
transmembrane domain 292 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SMG5 is involved in nonsense-mediated mRNA decay (Ohnishi et al., 2003 [PubMed 14636577]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Smg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Smg5 APN 3 88351428 nonsense probably null
IGL00902:Smg5 APN 3 88353085 missense probably benign 0.00
IGL00990:Smg5 APN 3 88343038 critical splice donor site probably null
IGL01371:Smg5 APN 3 88359644 unclassified probably benign
IGL01536:Smg5 APN 3 88349245 missense possibly damaging 0.58
IGL02215:Smg5 APN 3 88352998 missense possibly damaging 0.47
IGL03366:Smg5 APN 3 88346452 nonsense probably null
R0013:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0017:Smg5 UTSW 3 88351105 missense probably damaging 1.00
R0129:Smg5 UTSW 3 88349233 missense probably benign 0.00
R0153:Smg5 UTSW 3 88353872 unclassified probably benign
R1386:Smg5 UTSW 3 88355671 missense probably damaging 1.00
R1941:Smg5 UTSW 3 88345380 missense possibly damaging 0.71
R2185:Smg5 UTSW 3 88351561 missense probably benign
R2282:Smg5 UTSW 3 88345398 missense probably benign 0.02
R3615:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R3616:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4008:Smg5 UTSW 3 88349158 missense probably benign 0.01
R4687:Smg5 UTSW 3 88342469 missense possibly damaging 0.83
R4726:Smg5 UTSW 3 88336451 missense possibly damaging 0.94
R4801:Smg5 UTSW 3 88355692 nonsense probably null
R4802:Smg5 UTSW 3 88355692 nonsense probably null
R4977:Smg5 UTSW 3 88355725 nonsense probably null
R5384:Smg5 UTSW 3 88351293 missense probably damaging 1.00
R5443:Smg5 UTSW 3 88354589 missense probably damaging 0.99
R5779:Smg5 UTSW 3 88351618 unclassified probably benign
R5860:Smg5 UTSW 3 88342907 missense probably damaging 0.97
R6080:Smg5 UTSW 3 88351509 missense probably benign
R6263:Smg5 UTSW 3 88341901 missense possibly damaging 0.90
R6431:Smg5 UTSW 3 88351220 missense probably benign 0.00
R6722:Smg5 UTSW 3 88353025 missense probably damaging 0.99
R6847:Smg5 UTSW 3 88342552 missense probably damaging 1.00
R6950:Smg5 UTSW 3 88349269 critical splice donor site probably null
R7091:Smg5 UTSW 3 88351347 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCATTTGGACAGCCCCAGTG -3'
(R):5'- CTGATTTCGCCTTGGCAAC -3'

Sequencing Primer
(F):5'- CATGCAGGTGAGTCTCGG -3'
(R):5'- TCCCTGCAGCCTCAGTG -3'
Posted On2019-09-13