Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Plb1'

573719

Institutional Source

Beutler Lab

Gene Symbol

Plb1

Ensembl Gene

ENSMUSG00000029134

Gene Name

phospholipase B1

Synonyms

4930539A06Rik, 4632413E21Rik, 4930433E17Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.060) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

32232708-32366520 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32353684 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 1298 (K1298E)

Ref Sequence

ENSEMBL: ENSMUSP00000098927 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]

AlphaFold

Q3TTY0

Predicted Effect

probably benign
Transcript: ENSMUST00000101376
AA Change: K1298E

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: K1298E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202220
AA Change: K1298E

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: K1298E

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Plb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Plb1	APN	5	32345736	missense	probably benign	0.00
IGL00542:Plb1	APN	5	32269834	missense	probably benign	0.02
IGL00835:Plb1	APN	5	32364172	missense	unknown
IGL00954:Plb1	APN	5	32298514	splice site	probably benign
IGL01350:Plb1	APN	5	32317064	missense	probably damaging	1.00
IGL01527:Plb1	APN	5	32317123	missense	probably damaging	1.00
IGL01599:Plb1	APN	5	32342544	splice site	probably benign
IGL01690:Plb1	APN	5	32313697	missense	probably damaging	1.00
IGL01813:Plb1	APN	5	32329085	missense	probably damaging	1.00
IGL01826:Plb1	APN	5	32281145	missense	probably damaging	0.99
IGL02263:Plb1	APN	5	32321348	splice site	probably benign
IGL02314:Plb1	APN	5	32281148	missense	possibly damaging	0.93
IGL02649:Plb1	APN	5	32362568	missense	probably benign	0.09
IGL02701:Plb1	APN	5	32364197	missense	unknown
IGL02704:Plb1	APN	5	32353667	missense	probably benign	0.03
IGL03170:Plb1	APN	5	32284902	missense	probably damaging	0.99
IGL03182:Plb1	APN	5	32344915	splice site	probably benign
IGL03326:Plb1	APN	5	32331327	missense	probably benign	0.00
IGL03046:Plb1	UTSW	5	32328412	missense	probably damaging	1.00
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0330:Plb1	UTSW	5	32355357	missense	probably damaging	1.00
R0413:Plb1	UTSW	5	32355362	missense	probably damaging	1.00
R0721:Plb1	UTSW	5	32364195	missense	unknown
R0735:Plb1	UTSW	5	32284920	missense	possibly damaging	0.90
R1423:Plb1	UTSW	5	32293257	missense	probably benign
R1428:Plb1	UTSW	5	32264912	missense	possibly damaging	0.82
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1694:Plb1	UTSW	5	32317277	missense	probably null	0.01
R1801:Plb1	UTSW	5	32293243	missense	probably damaging	1.00
R1804:Plb1	UTSW	5	32353697	missense	possibly damaging	0.91
R1900:Plb1	UTSW	5	32286847	missense	probably benign	0.44
R1903:Plb1	UTSW	5	32291238	missense	probably damaging	1.00
R2101:Plb1	UTSW	5	32349660	missense	probably damaging	1.00
R2153:Plb1	UTSW	5	32314089	missense	probably damaging	1.00
R2207:Plb1	UTSW	5	32316640	missense	possibly damaging	0.50
R2270:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2271:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2311:Plb1	UTSW	5	32269818	missense	probably benign	0.01
R2850:Plb1	UTSW	5	32293224	missense	probably benign
R3103:Plb1	UTSW	5	32328029	missense	possibly damaging	0.92
R4444:Plb1	UTSW	5	32330565	missense	probably benign	0.06
R4559:Plb1	UTSW	5	32332831	missense	probably damaging	0.99
R4577:Plb1	UTSW	5	32247557	nonsense	probably null
R4578:Plb1	UTSW	5	32247557	nonsense	probably null
R4739:Plb1	UTSW	5	32349679	splice site	probably null
R4747:Plb1	UTSW	5	32349659	missense	probably benign	0.08
R4806:Plb1	UTSW	5	32289852	missense	probably damaging	1.00
R5406:Plb1	UTSW	5	32341915	missense	probably damaging	1.00
R5567:Plb1	UTSW	5	32364199	missense	unknown
R5574:Plb1	UTSW	5	32329947	missense	probably benign	0.13
R5588:Plb1	UTSW	5	32329949	critical splice donor site	probably null
R5619:Plb1	UTSW	5	32333497	missense	probably damaging	0.99
R5769:Plb1	UTSW	5	32317522	missense	probably benign	0.05
R6366:Plb1	UTSW	5	32314085	missense	possibly damaging	0.59
R6700:Plb1	UTSW	5	32333464	missense	probably damaging	0.99
R7162:Plb1	UTSW	5	32349663	missense	probably benign	0.30
R7379:Plb1	UTSW	5	32345639	missense	probably damaging	1.00
R7426:Plb1	UTSW	5	32321247	splice site	probably null
R7643:Plb1	UTSW	5	32247557	nonsense	probably null
R7657:Plb1	UTSW	5	32329867	missense	probably damaging	0.98
R7780:Plb1	UTSW	5	32326266	splice site	probably null
R8040:Plb1	UTSW	5	32273069	missense	possibly damaging	0.89
R8212:Plb1	UTSW	5	32264906	missense	probably damaging	1.00
R8312:Plb1	UTSW	5	32328485	missense	probably damaging	1.00
R8560:Plb1	UTSW	5	32302679	missense	possibly damaging	0.95
R8770:Plb1	UTSW	5	32247509	missense	unknown
R8857:Plb1	UTSW	5	32364212	missense	unknown
R9029:Plb1	UTSW	5	32281735	missense	probably damaging	0.99
R9110:Plb1	UTSW	5	32364058	missense	probably benign	0.00
R9765:Plb1	UTSW	5	32355387	missense	probably damaging	1.00
X0018:Plb1	UTSW	5	32285883	missense	probably benign	0.01
X0019:Plb1	UTSW	5	32353697	missense	probably damaging	0.99
X0027:Plb1	UTSW	5	32270358	missense	probably benign
X0028:Plb1	UTSW	5	32302675	missense	probably damaging	1.00
Z1088:Plb1	UTSW	5	32310847	missense	probably damaging	0.99
Z1088:Plb1	UTSW	5	32310917	missense	probably benign
Z1177:Plb1	UTSW	5	32284897	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CAACCACATTCCTGAGTTAAGGC -3'
(R):5'- CCCCAGGTAAATAGTGTGAGG -3'

Sequencing Primer
(F):5'- GACTTAGACCCAAGTGTTTTAGGC -3'
(R):5'- TAAATAGTGTGAGGAATAGGATCTCC -3'

Posted On

2019-09-13