Incidental Mutation 'R7395:Vmn2r52'
ID 573734
Institutional Source Beutler Lab
Gene Symbol Vmn2r52
Ensembl Gene ENSMUSG00000091930
Gene Name vomeronasal 2, receptor 52
Synonyms EG384534
MMRRC Submission 045477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R7395 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 9892579-9910213 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 9904744 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Tyrosine at position 365 (C365Y)
Ref Sequence ENSEMBL: ENSMUSP00000129352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164918]
AlphaFold L7N2B2
Predicted Effect probably benign
Transcript: ENSMUST00000164918
AA Change: C365Y

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000129352
Gene: ENSMUSG00000091930
AA Change: C365Y

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 8.1e-29 PFAM
Pfam:NCD3G 512 565 1.5e-19 PFAM
Pfam:7tm_3 596 833 1.1e-55 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 55,184,140 (GRCm39) probably null Het
4930433I11Rik A T 7: 40,639,102 (GRCm39) T13S probably damaging Het
Abca13 A G 11: 9,241,658 (GRCm39) I1174V probably benign Het
Acoxl G A 2: 127,726,336 (GRCm39) V237M probably damaging Het
Adam33 A C 2: 130,903,089 (GRCm39) W52G probably benign Het
Adgrv1 T C 13: 81,707,467 (GRCm39) H1313R probably damaging Het
Ap3d1 T C 10: 80,566,716 (GRCm39) T89A probably benign Het
Armc8 T C 9: 99,415,185 (GRCm39) E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,949 (GRCm39) *383Q probably null Het
Atp8b4 A T 2: 126,217,614 (GRCm39) L634Q possibly damaging Het
B3glct A G 5: 149,649,069 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Bicd2 A G 13: 49,531,706 (GRCm39) D316G possibly damaging Het
Bop1 A T 15: 76,338,041 (GRCm39) S610T probably damaging Het
Car11 T A 7: 45,350,745 (GRCm39) Y80* probably null Het
Ccdc121rt2 A T 5: 112,598,035 (GRCm39) E194V possibly damaging Het
Ccdc96 T C 5: 36,642,609 (GRCm39) I205T probably benign Het
Ces2a A G 8: 105,466,273 (GRCm39) E390G probably benign Het
Cfap54 C A 10: 92,720,565 (GRCm39) V2630L unknown Het
Chek2 G T 5: 111,019,974 (GRCm39) probably null Het
Cntn3 C T 6: 102,314,355 (GRCm39) probably null Het
Cpne3 A T 4: 19,528,239 (GRCm39) D339E probably damaging Het
Crocc2 C T 1: 93,143,829 (GRCm39) Q1403* probably null Het
Crppa A T 12: 36,551,994 (GRCm39) I283F possibly damaging Het
Csnka2ip G A 16: 64,299,803 (GRCm39) T187I Het
Ctu1 A G 7: 43,326,019 (GRCm39) H226R possibly damaging Het
Cubn G T 2: 13,291,875 (GRCm39) Q3317K probably damaging Het
Cyp17a1 A G 19: 46,659,134 (GRCm39) L169P probably benign Het
Dcc T A 18: 71,507,640 (GRCm39) K911* probably null Het
Dcun1d2 G A 8: 13,328,675 (GRCm39) R75* probably null Het
Defb19 A T 2: 152,421,943 (GRCm39) probably null Het
Dffb A T 4: 154,053,570 (GRCm39) S257R probably damaging Het
Dip2c A C 13: 9,664,413 (GRCm39) N942T probably damaging Het
Dnah3 T A 7: 119,565,474 (GRCm39) I169F Het
Dnah3 T C 7: 119,660,183 (GRCm39) M830V probably benign Het
Dnajc5g G A 5: 31,269,009 (GRCm39) S130N possibly damaging Het
Dscaml1 C A 9: 45,613,703 (GRCm39) Q939K possibly damaging Het
Evpl G C 11: 116,117,905 (GRCm39) N761K possibly damaging Het
Fbxw8 A T 5: 118,206,280 (GRCm39) I556N probably damaging Het
Fry G T 5: 150,304,348 (GRCm39) M579I possibly damaging Het
Ggt7 A T 2: 155,337,800 (GRCm39) M488K probably benign Het
Gnpnat1 T A 14: 45,619,038 (GRCm39) H107L probably benign Het
Golga2 C A 2: 32,195,599 (GRCm39) P798Q possibly damaging Het
Gpr35 G A 1: 92,910,929 (GRCm39) A214T probably damaging Het
Greb1 A T 12: 16,759,431 (GRCm39) probably null Het
Hdac10 G A 15: 89,012,487 (GRCm39) T32I probably benign Het
Hkdc1 G A 10: 62,221,478 (GRCm39) T860I probably damaging Het
Icam5 C A 9: 20,946,738 (GRCm39) P422Q possibly damaging Het
Ist1 A C 8: 110,404,159 (GRCm39) S238A probably benign Het
Lrig2 T C 3: 104,404,836 (GRCm39) N91D probably benign Het
Mapt A C 11: 104,218,949 (GRCm39) D352A probably damaging Het
Micall2 G A 5: 139,702,124 (GRCm39) P373L possibly damaging Het
Mocs1 A G 17: 49,761,585 (GRCm39) S560G possibly damaging Het
Mpo A G 11: 87,691,950 (GRCm39) D461G probably damaging Het
Myo1a G T 10: 127,546,309 (GRCm39) V271L probably damaging Het
Ncoa1 G A 12: 4,345,188 (GRCm39) P720S not run Het
Ncr1 T A 7: 4,341,150 (GRCm39) I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 (GRCm39) R66C probably damaging Het
Obox5 A T 7: 15,492,668 (GRCm39) S208C probably damaging Het
Or10q1 T C 19: 13,726,502 (GRCm39) S11P probably damaging Het
Or2n1d A T 17: 38,646,755 (GRCm39) K236* probably null Het
Or5p75-ps1 T A 7: 108,107,611 (GRCm39) F116Y unknown Het
Or7d9 T A 9: 20,197,826 (GRCm39) M285K probably damaging Het
Padi4 A C 4: 140,488,983 (GRCm39) V152G probably damaging Het
Pdzd7 A T 19: 45,025,450 (GRCm39) D348E probably damaging Het
Pdzph1 T A 17: 59,186,154 (GRCm39) K1212N possibly damaging Het
Piezo2 C T 18: 63,160,634 (GRCm39) G2341R probably damaging Het
Plb1 A G 5: 32,511,028 (GRCm39) K1298E probably benign Het
Prr14l A G 5: 32,985,982 (GRCm39) L1171P probably benign Het
Rab11fip5 T C 6: 85,318,850 (GRCm39) T680A probably benign Het
Rev1 A T 1: 38,127,146 (GRCm39) N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Ryr2 A G 13: 11,799,997 (GRCm39) C917R probably damaging Het
Sall1 A T 8: 89,757,549 (GRCm39) S852T possibly damaging Het
Serpine2 A G 1: 79,779,272 (GRCm39) F296L probably damaging Het
Slc12a6 A T 2: 112,182,887 (GRCm39) N754I probably damaging Het
Slc39a6 A T 18: 24,718,332 (GRCm39) L575Q probably damaging Het
Smarcc2 T A 10: 128,321,475 (GRCm39) L890Q probably damaging Het
Smg5 T A 3: 88,268,378 (GRCm39) V1006D probably damaging Het
Ssh2 T C 11: 77,283,899 (GRCm39) V51A probably damaging Het
St14 T C 9: 31,008,195 (GRCm39) K547E probably benign Het
Stag1 T G 9: 100,678,781 (GRCm39) V234G probably damaging Het
Stag3 A T 5: 138,280,207 (GRCm39) Q24L probably benign Het
Stra6 T C 9: 58,048,380 (GRCm39) Y158H probably damaging Het
Tcstv1a A T 13: 120,355,666 (GRCm39) probably null Het
Tmem196 G A 12: 119,975,002 (GRCm39) C62Y probably damaging Het
Tmem265 T A 7: 127,164,039 (GRCm39) F84L Het
Tph1 C T 7: 46,306,627 (GRCm39) probably null Het
Ttn A G 2: 76,776,834 (GRCm39) I1522T unknown Het
Ulk4 T A 9: 121,084,178 (GRCm39) Q129L probably benign Het
Usp17la T A 7: 104,510,792 (GRCm39) S466T probably benign Het
Vmn2r31 A T 7: 7,387,744 (GRCm39) V609E probably damaging Het
Zbtb4 A T 11: 69,666,937 (GRCm39) T81S possibly damaging Het
Zfp605 A T 5: 110,259,885 (GRCm39) probably benign Het
Other mutations in Vmn2r52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Vmn2r52 APN 7 9,903,023 (GRCm39) missense probably benign 0.30
IGL00328:Vmn2r52 APN 7 9,905,344 (GRCm39) missense probably benign 0.12
IGL00980:Vmn2r52 APN 7 9,905,017 (GRCm39) missense probably damaging 1.00
IGL01468:Vmn2r52 APN 7 9,892,868 (GRCm39) missense probably damaging 1.00
IGL01660:Vmn2r52 APN 7 9,893,107 (GRCm39) missense probably damaging 0.97
IGL02215:Vmn2r52 APN 7 9,905,029 (GRCm39) missense probably damaging 0.97
IGL03030:Vmn2r52 APN 7 9,892,799 (GRCm39) missense probably benign 0.12
IGL03212:Vmn2r52 APN 7 9,893,474 (GRCm39) missense possibly damaging 0.47
FR4589:Vmn2r52 UTSW 7 9,892,947 (GRCm39) missense probably damaging 0.97
PIT4283001:Vmn2r52 UTSW 7 9,904,756 (GRCm39) missense possibly damaging 0.89
R0184:Vmn2r52 UTSW 7 9,893,265 (GRCm39) missense probably damaging 1.00
R0190:Vmn2r52 UTSW 7 9,905,315 (GRCm39) missense probably benign 0.00
R0240:Vmn2r52 UTSW 7 9,893,327 (GRCm39) missense probably damaging 0.99
R0240:Vmn2r52 UTSW 7 9,893,327 (GRCm39) missense probably damaging 0.99
R0257:Vmn2r52 UTSW 7 9,904,982 (GRCm39) nonsense probably null
R0310:Vmn2r52 UTSW 7 9,893,393 (GRCm39) missense probably damaging 1.00
R1831:Vmn2r52 UTSW 7 9,893,415 (GRCm39) missense probably damaging 1.00
R1862:Vmn2r52 UTSW 7 9,907,333 (GRCm39) missense possibly damaging 0.94
R2484:Vmn2r52 UTSW 7 9,903,058 (GRCm39) missense probably damaging 0.96
R2510:Vmn2r52 UTSW 7 9,904,795 (GRCm39) missense probably benign
R3625:Vmn2r52 UTSW 7 9,893,105 (GRCm39) missense probably damaging 1.00
R3803:Vmn2r52 UTSW 7 9,907,439 (GRCm39) missense probably damaging 1.00
R4013:Vmn2r52 UTSW 7 9,904,603 (GRCm39) missense probably benign 0.00
R4283:Vmn2r52 UTSW 7 9,904,565 (GRCm39) missense possibly damaging 0.60
R4324:Vmn2r52 UTSW 7 9,904,940 (GRCm39) missense possibly damaging 0.94
R4578:Vmn2r52 UTSW 7 9,904,617 (GRCm39) missense probably damaging 1.00
R4806:Vmn2r52 UTSW 7 9,893,169 (GRCm39) missense probably damaging 1.00
R5083:Vmn2r52 UTSW 7 9,893,392 (GRCm39) nonsense probably null
R5249:Vmn2r52 UTSW 7 9,910,197 (GRCm39) missense probably benign
R5306:Vmn2r52 UTSW 7 9,904,672 (GRCm39) missense possibly damaging 0.88
R5332:Vmn2r52 UTSW 7 9,903,052 (GRCm39) missense probably benign 0.17
R5617:Vmn2r52 UTSW 7 9,904,861 (GRCm39) missense probably damaging 0.99
R5643:Vmn2r52 UTSW 7 9,905,059 (GRCm39) missense probably damaging 1.00
R5749:Vmn2r52 UTSW 7 9,892,959 (GRCm39) missense probably damaging 1.00
R5763:Vmn2r52 UTSW 7 9,905,231 (GRCm39) missense probably benign 0.01
R6103:Vmn2r52 UTSW 7 9,905,327 (GRCm39) missense probably benign 0.36
R6148:Vmn2r52 UTSW 7 9,905,090 (GRCm39) missense probably benign 0.00
R6356:Vmn2r52 UTSW 7 9,902,926 (GRCm39) missense probably benign 0.01
R6412:Vmn2r52 UTSW 7 9,904,936 (GRCm39) missense probably benign
R6657:Vmn2r52 UTSW 7 9,893,090 (GRCm39) missense probably damaging 0.99
R6997:Vmn2r52 UTSW 7 9,902,998 (GRCm39) missense probably benign 0.06
R7621:Vmn2r52 UTSW 7 9,907,274 (GRCm39) missense probably benign 0.00
R7691:Vmn2r52 UTSW 7 9,893,109 (GRCm39) missense probably damaging 0.97
R7852:Vmn2r52 UTSW 7 9,892,895 (GRCm39) missense probably damaging 1.00
R7908:Vmn2r52 UTSW 7 9,896,877 (GRCm39) missense probably benign
R7909:Vmn2r52 UTSW 7 9,896,877 (GRCm39) missense probably benign
R7912:Vmn2r52 UTSW 7 9,896,877 (GRCm39) missense probably benign
R7913:Vmn2r52 UTSW 7 9,896,877 (GRCm39) missense probably benign
R7938:Vmn2r52 UTSW 7 9,893,300 (GRCm39) missense probably benign 0.12
R8884:Vmn2r52 UTSW 7 9,892,734 (GRCm39) missense probably damaging 1.00
R9003:Vmn2r52 UTSW 7 9,905,181 (GRCm39) missense probably benign 0.07
R9140:Vmn2r52 UTSW 7 9,892,643 (GRCm39) missense probably damaging 0.99
R9141:Vmn2r52 UTSW 7 9,905,331 (GRCm39) nonsense probably null
R9500:Vmn2r52 UTSW 7 9,905,281 (GRCm39) missense probably damaging 1.00
R9562:Vmn2r52 UTSW 7 9,893,476 (GRCm39) missense probably benign 0.22
R9564:Vmn2r52 UTSW 7 9,905,182 (GRCm39) missense probably benign 0.15
R9565:Vmn2r52 UTSW 7 9,893,476 (GRCm39) missense probably benign 0.22
R9597:Vmn2r52 UTSW 7 9,904,719 (GRCm39) nonsense probably null
R9743:Vmn2r52 UTSW 7 9,904,606 (GRCm39) missense possibly damaging 0.81
Z1176:Vmn2r52 UTSW 7 9,905,127 (GRCm39) missense probably damaging 0.97
Z1177:Vmn2r52 UTSW 7 9,903,117 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCAAGCAGTGAGAACTGGCTAC -3'
(R):5'- GTACAACTGAATTTCCCTACCAGTAAG -3'

Sequencing Primer
(F):5'- AGCAGTGAGAACTGGCTACTTTTCC -3'
(R):5'- GTAAGAAAGACTTAACTCATGGCC -3'
Posted On 2019-09-13