Incidental Mutation 'R7395:Dnah3'
ID 573741
Institutional Source Beutler Lab
Gene Symbol Dnah3
Ensembl Gene ENSMUSG00000052273
Gene Name dynein, axonemal, heavy chain 3
Synonyms Dnahc3
MMRRC Submission 045477-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7395 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 119521894-119694503 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119565474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 169 (I169F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000046993
AA Change: I2556F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: I2556F

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 805 820 N/A INTRINSIC
Pfam:DHC_N2 826 1235 3.3e-144 PFAM
AAA 1388 1527 1.59e-1 SMART
low complexity region 1594 1606 N/A INTRINSIC
Blast:AAA 1669 1897 9e-84 BLAST
AAA 2033 2180 1.33e-3 SMART
Pfam:AAA_8 2362 2632 1.5e-63 PFAM
Pfam:MT 2644 2994 7.4e-52 PFAM
Pfam:AAA_9 3015 3240 3.5e-92 PFAM
low complexity region 3338 3349 N/A INTRINSIC
Pfam:Dynein_heavy 3376 4079 4.4e-285 PFAM
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000209154
AA Change: I2545F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000213149
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 55,184,140 (GRCm39) probably null Het
4930433I11Rik A T 7: 40,639,102 (GRCm39) T13S probably damaging Het
Abca13 A G 11: 9,241,658 (GRCm39) I1174V probably benign Het
Acoxl G A 2: 127,726,336 (GRCm39) V237M probably damaging Het
Adam33 A C 2: 130,903,089 (GRCm39) W52G probably benign Het
Adgrv1 T C 13: 81,707,467 (GRCm39) H1313R probably damaging Het
Ap3d1 T C 10: 80,566,716 (GRCm39) T89A probably benign Het
Armc8 T C 9: 99,415,185 (GRCm39) E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,949 (GRCm39) *383Q probably null Het
Atp8b4 A T 2: 126,217,614 (GRCm39) L634Q possibly damaging Het
B3glct A G 5: 149,649,069 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Bicd2 A G 13: 49,531,706 (GRCm39) D316G possibly damaging Het
Bop1 A T 15: 76,338,041 (GRCm39) S610T probably damaging Het
Car11 T A 7: 45,350,745 (GRCm39) Y80* probably null Het
Ccdc121rt2 A T 5: 112,598,035 (GRCm39) E194V possibly damaging Het
Ccdc96 T C 5: 36,642,609 (GRCm39) I205T probably benign Het
Ces2a A G 8: 105,466,273 (GRCm39) E390G probably benign Het
Cfap54 C A 10: 92,720,565 (GRCm39) V2630L unknown Het
Chek2 G T 5: 111,019,974 (GRCm39) probably null Het
Cntn3 C T 6: 102,314,355 (GRCm39) probably null Het
Cpne3 A T 4: 19,528,239 (GRCm39) D339E probably damaging Het
Crocc2 C T 1: 93,143,829 (GRCm39) Q1403* probably null Het
Crppa A T 12: 36,551,994 (GRCm39) I283F possibly damaging Het
Csnka2ip G A 16: 64,299,803 (GRCm39) T187I Het
Ctu1 A G 7: 43,326,019 (GRCm39) H226R possibly damaging Het
Cubn G T 2: 13,291,875 (GRCm39) Q3317K probably damaging Het
Cyp17a1 A G 19: 46,659,134 (GRCm39) L169P probably benign Het
Dcc T A 18: 71,507,640 (GRCm39) K911* probably null Het
Dcun1d2 G A 8: 13,328,675 (GRCm39) R75* probably null Het
Defb19 A T 2: 152,421,943 (GRCm39) probably null Het
Dffb A T 4: 154,053,570 (GRCm39) S257R probably damaging Het
Dip2c A C 13: 9,664,413 (GRCm39) N942T probably damaging Het
Dnajc5g G A 5: 31,269,009 (GRCm39) S130N possibly damaging Het
Dscaml1 C A 9: 45,613,703 (GRCm39) Q939K possibly damaging Het
Evpl G C 11: 116,117,905 (GRCm39) N761K possibly damaging Het
Fbxw8 A T 5: 118,206,280 (GRCm39) I556N probably damaging Het
Fry G T 5: 150,304,348 (GRCm39) M579I possibly damaging Het
Ggt7 A T 2: 155,337,800 (GRCm39) M488K probably benign Het
Gnpnat1 T A 14: 45,619,038 (GRCm39) H107L probably benign Het
Golga2 C A 2: 32,195,599 (GRCm39) P798Q possibly damaging Het
Gpr35 G A 1: 92,910,929 (GRCm39) A214T probably damaging Het
Greb1 A T 12: 16,759,431 (GRCm39) probably null Het
Hdac10 G A 15: 89,012,487 (GRCm39) T32I probably benign Het
Hkdc1 G A 10: 62,221,478 (GRCm39) T860I probably damaging Het
Icam5 C A 9: 20,946,738 (GRCm39) P422Q possibly damaging Het
Ist1 A C 8: 110,404,159 (GRCm39) S238A probably benign Het
Lrig2 T C 3: 104,404,836 (GRCm39) N91D probably benign Het
Mapt A C 11: 104,218,949 (GRCm39) D352A probably damaging Het
Micall2 G A 5: 139,702,124 (GRCm39) P373L possibly damaging Het
Mocs1 A G 17: 49,761,585 (GRCm39) S560G possibly damaging Het
Mpo A G 11: 87,691,950 (GRCm39) D461G probably damaging Het
Myo1a G T 10: 127,546,309 (GRCm39) V271L probably damaging Het
Ncoa1 G A 12: 4,345,188 (GRCm39) P720S not run Het
Ncr1 T A 7: 4,341,150 (GRCm39) I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 (GRCm39) R66C probably damaging Het
Obox5 A T 7: 15,492,668 (GRCm39) S208C probably damaging Het
Or10q1 T C 19: 13,726,502 (GRCm39) S11P probably damaging Het
Or2n1d A T 17: 38,646,755 (GRCm39) K236* probably null Het
Or5p75-ps1 T A 7: 108,107,611 (GRCm39) F116Y unknown Het
Or7d9 T A 9: 20,197,826 (GRCm39) M285K probably damaging Het
Padi4 A C 4: 140,488,983 (GRCm39) V152G probably damaging Het
Pdzd7 A T 19: 45,025,450 (GRCm39) D348E probably damaging Het
Pdzph1 T A 17: 59,186,154 (GRCm39) K1212N possibly damaging Het
Piezo2 C T 18: 63,160,634 (GRCm39) G2341R probably damaging Het
Plb1 A G 5: 32,511,028 (GRCm39) K1298E probably benign Het
Prr14l A G 5: 32,985,982 (GRCm39) L1171P probably benign Het
Rab11fip5 T C 6: 85,318,850 (GRCm39) T680A probably benign Het
Rev1 A T 1: 38,127,146 (GRCm39) N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Ryr2 A G 13: 11,799,997 (GRCm39) C917R probably damaging Het
Sall1 A T 8: 89,757,549 (GRCm39) S852T possibly damaging Het
Serpine2 A G 1: 79,779,272 (GRCm39) F296L probably damaging Het
Slc12a6 A T 2: 112,182,887 (GRCm39) N754I probably damaging Het
Slc39a6 A T 18: 24,718,332 (GRCm39) L575Q probably damaging Het
Smarcc2 T A 10: 128,321,475 (GRCm39) L890Q probably damaging Het
Smg5 T A 3: 88,268,378 (GRCm39) V1006D probably damaging Het
Ssh2 T C 11: 77,283,899 (GRCm39) V51A probably damaging Het
St14 T C 9: 31,008,195 (GRCm39) K547E probably benign Het
Stag1 T G 9: 100,678,781 (GRCm39) V234G probably damaging Het
Stag3 A T 5: 138,280,207 (GRCm39) Q24L probably benign Het
Stra6 T C 9: 58,048,380 (GRCm39) Y158H probably damaging Het
Tcstv1a A T 13: 120,355,666 (GRCm39) probably null Het
Tmem196 G A 12: 119,975,002 (GRCm39) C62Y probably damaging Het
Tmem265 T A 7: 127,164,039 (GRCm39) F84L Het
Tph1 C T 7: 46,306,627 (GRCm39) probably null Het
Ttn A G 2: 76,776,834 (GRCm39) I1522T unknown Het
Ulk4 T A 9: 121,084,178 (GRCm39) Q129L probably benign Het
Usp17la T A 7: 104,510,792 (GRCm39) S466T probably benign Het
Vmn2r31 A T 7: 7,387,744 (GRCm39) V609E probably damaging Het
Vmn2r52 C T 7: 9,904,744 (GRCm39) C365Y probably benign Het
Zbtb4 A T 11: 69,666,937 (GRCm39) T81S possibly damaging Het
Zfp605 A T 5: 110,259,885 (GRCm39) probably benign Het
Other mutations in Dnah3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Dnah3 APN 7 119,538,128 (GRCm39) missense possibly damaging 0.88
IGL01095:Dnah3 APN 7 119,550,820 (GRCm39) missense probably benign 0.02
IGL01329:Dnah3 APN 7 119,622,164 (GRCm39) missense probably damaging 1.00
IGL01380:Dnah3 APN 7 119,525,787 (GRCm39) missense probably damaging 1.00
IGL01410:Dnah3 APN 7 119,566,943 (GRCm39) missense possibly damaging 0.91
IGL01487:Dnah3 APN 7 119,564,753 (GRCm39) nonsense probably null
IGL01843:Dnah3 APN 7 119,542,798 (GRCm39) missense probably benign 0.12
IGL01929:Dnah3 APN 7 119,550,874 (GRCm39) nonsense probably null
IGL01994:Dnah3 APN 7 119,550,437 (GRCm39) missense possibly damaging 0.58
IGL02115:Dnah3 APN 7 119,628,277 (GRCm39) missense probably damaging 1.00
IGL02273:Dnah3 APN 7 119,550,494 (GRCm39) missense probably damaging 1.00
IGL02299:Dnah3 APN 7 119,566,802 (GRCm39) missense probably benign 0.39
IGL02421:Dnah3 APN 7 119,550,215 (GRCm39) missense possibly damaging 0.87
IGL02514:Dnah3 APN 7 119,565,470 (GRCm39) missense probably damaging 1.00
IGL02596:Dnah3 APN 7 119,538,137 (GRCm39) missense probably benign 0.19
IGL02716:Dnah3 APN 7 119,536,246 (GRCm39) missense probably damaging 0.97
IGL02738:Dnah3 APN 7 119,564,720 (GRCm39) missense probably benign
IGL03404:Dnah3 APN 7 119,538,200 (GRCm39) missense probably damaging 1.00
R0964_Dnah3_480 UTSW 7 119,551,962 (GRCm39) splice site probably benign
R1778_Dnah3_238 UTSW 7 119,677,625 (GRCm39) missense probably damaging 1.00
R4658_Dnah3_599 UTSW 7 119,549,874 (GRCm39) missense probably damaging 1.00
BB004:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
BB014:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
R0011:Dnah3 UTSW 7 119,618,924 (GRCm39) missense probably damaging 1.00
R0195:Dnah3 UTSW 7 119,676,998 (GRCm39) critical splice donor site probably null
R0241:Dnah3 UTSW 7 119,521,953 (GRCm39) missense probably damaging 1.00
R0241:Dnah3 UTSW 7 119,521,953 (GRCm39) missense probably damaging 1.00
R0312:Dnah3 UTSW 7 119,644,882 (GRCm39) missense probably damaging 1.00
R0316:Dnah3 UTSW 7 119,564,882 (GRCm39) missense possibly damaging 0.94
R0370:Dnah3 UTSW 7 119,685,943 (GRCm39) missense possibly damaging 0.91
R0426:Dnah3 UTSW 7 119,542,795 (GRCm39) missense probably benign 0.11
R0525:Dnah3 UTSW 7 119,527,977 (GRCm39) missense probably damaging 1.00
R0625:Dnah3 UTSW 7 119,671,110 (GRCm39) missense possibly damaging 0.68
R0627:Dnah3 UTSW 7 119,620,138 (GRCm39) missense probably damaging 1.00
R0632:Dnah3 UTSW 7 119,567,128 (GRCm39) missense probably benign 0.11
R0928:Dnah3 UTSW 7 119,629,274 (GRCm39) missense probably damaging 1.00
R0964:Dnah3 UTSW 7 119,551,962 (GRCm39) splice site probably benign
R0972:Dnah3 UTSW 7 119,634,563 (GRCm39) splice site probably null
R1066:Dnah3 UTSW 7 119,660,232 (GRCm39) missense probably damaging 1.00
R1082:Dnah3 UTSW 7 119,677,668 (GRCm39) missense probably damaging 1.00
R1127:Dnah3 UTSW 7 119,522,253 (GRCm39) missense probably damaging 1.00
R1132:Dnah3 UTSW 7 119,538,227 (GRCm39) missense possibly damaging 0.50
R1222:Dnah3 UTSW 7 119,689,899 (GRCm39) missense probably benign 0.28
R1420:Dnah3 UTSW 7 119,551,202 (GRCm39) missense probably damaging 0.99
R1456:Dnah3 UTSW 7 119,646,853 (GRCm39) missense probably damaging 1.00
R1472:Dnah3 UTSW 7 119,670,181 (GRCm39) missense probably benign 0.12
R1617:Dnah3 UTSW 7 119,689,169 (GRCm39) missense probably benign 0.01
R1624:Dnah3 UTSW 7 119,618,918 (GRCm39) missense probably damaging 0.99
R1654:Dnah3 UTSW 7 119,525,672 (GRCm39) missense probably damaging 1.00
R1673:Dnah3 UTSW 7 119,570,402 (GRCm39) nonsense probably null
R1677:Dnah3 UTSW 7 119,527,963 (GRCm39) missense probably damaging 1.00
R1687:Dnah3 UTSW 7 119,645,009 (GRCm39) splice site probably null
R1711:Dnah3 UTSW 7 119,677,794 (GRCm39) missense probably damaging 1.00
R1738:Dnah3 UTSW 7 119,634,582 (GRCm39) missense probably damaging 1.00
R1778:Dnah3 UTSW 7 119,677,625 (GRCm39) missense probably damaging 1.00
R1866:Dnah3 UTSW 7 119,528,079 (GRCm39) splice site probably null
R1883:Dnah3 UTSW 7 119,677,142 (GRCm39) missense probably benign 0.06
R1894:Dnah3 UTSW 7 119,685,557 (GRCm39) missense probably benign 0.05
R1929:Dnah3 UTSW 7 119,574,352 (GRCm39) missense probably benign 0.10
R1988:Dnah3 UTSW 7 119,567,182 (GRCm39) missense probably damaging 0.99
R1988:Dnah3 UTSW 7 119,566,793 (GRCm39) missense possibly damaging 0.92
R2010:Dnah3 UTSW 7 119,694,400 (GRCm39) start codon destroyed probably benign 0.00
R2022:Dnah3 UTSW 7 119,550,465 (GRCm39) missense probably damaging 1.00
R2026:Dnah3 UTSW 7 119,638,629 (GRCm39) missense probably damaging 1.00
R2063:Dnah3 UTSW 7 119,551,132 (GRCm39) missense probably damaging 0.96
R2131:Dnah3 UTSW 7 119,566,982 (GRCm39) missense possibly damaging 0.93
R2152:Dnah3 UTSW 7 119,551,236 (GRCm39) missense probably benign 0.02
R2199:Dnah3 UTSW 7 119,550,792 (GRCm39) missense possibly damaging 0.89
R2271:Dnah3 UTSW 7 119,574,352 (GRCm39) missense probably benign 0.10
R2350:Dnah3 UTSW 7 119,645,011 (GRCm39) splice site probably null
R2567:Dnah3 UTSW 7 119,551,920 (GRCm39) missense possibly damaging 0.83
R2848:Dnah3 UTSW 7 119,567,161 (GRCm39) missense probably benign 0.01
R2902:Dnah3 UTSW 7 119,550,722 (GRCm39) missense possibly damaging 0.61
R2926:Dnah3 UTSW 7 119,550,338 (GRCm39) missense probably damaging 1.00
R2944:Dnah3 UTSW 7 119,550,333 (GRCm39) missense probably damaging 1.00
R3022:Dnah3 UTSW 7 119,677,704 (GRCm39) missense possibly damaging 0.93
R3401:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3402:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3403:Dnah3 UTSW 7 119,566,879 (GRCm39) missense probably benign 0.00
R3919:Dnah3 UTSW 7 119,550,303 (GRCm39) missense probably damaging 1.00
R3972:Dnah3 UTSW 7 119,685,943 (GRCm39) missense probably damaging 0.99
R4162:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4184:Dnah3 UTSW 7 119,682,516 (GRCm39) missense probably damaging 1.00
R4198:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4199:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4200:Dnah3 UTSW 7 119,522,061 (GRCm39) missense probably damaging 1.00
R4239:Dnah3 UTSW 7 119,628,248 (GRCm39) nonsense probably null
R4478:Dnah3 UTSW 7 119,671,086 (GRCm39) missense probably benign 0.00
R4579:Dnah3 UTSW 7 119,608,554 (GRCm39) missense probably damaging 1.00
R4600:Dnah3 UTSW 7 119,689,169 (GRCm39) missense probably benign
R4649:Dnah3 UTSW 7 119,646,921 (GRCm39) missense probably damaging 1.00
R4658:Dnah3 UTSW 7 119,549,874 (GRCm39) missense probably damaging 1.00
R4728:Dnah3 UTSW 7 119,658,589 (GRCm39) missense probably damaging 0.99
R4739:Dnah3 UTSW 7 119,677,169 (GRCm39) missense possibly damaging 0.54
R4758:Dnah3 UTSW 7 119,678,629 (GRCm39) missense probably benign 0.00
R4785:Dnah3 UTSW 7 119,567,047 (GRCm39) missense probably benign 0.29
R4789:Dnah3 UTSW 7 119,610,295 (GRCm39) missense probably damaging 1.00
R4930:Dnah3 UTSW 7 119,550,904 (GRCm39) nonsense probably null
R4935:Dnah3 UTSW 7 119,615,700 (GRCm39) nonsense probably null
R4946:Dnah3 UTSW 7 119,530,783 (GRCm39) missense probably damaging 1.00
R4981:Dnah3 UTSW 7 119,555,424 (GRCm39) missense probably benign 0.03
R4984:Dnah3 UTSW 7 119,528,002 (GRCm39) missense probably benign 0.04
R5025:Dnah3 UTSW 7 119,671,128 (GRCm39) missense probably benign 0.02
R5046:Dnah3 UTSW 7 119,550,803 (GRCm39) missense probably damaging 1.00
R5056:Dnah3 UTSW 7 119,620,169 (GRCm39) missense probably damaging 1.00
R5068:Dnah3 UTSW 7 119,632,013 (GRCm39) missense probably benign
R5069:Dnah3 UTSW 7 119,632,013 (GRCm39) missense probably benign
R5154:Dnah3 UTSW 7 119,551,642 (GRCm39) missense probably damaging 1.00
R5208:Dnah3 UTSW 7 119,631,861 (GRCm39) missense probably damaging 1.00
R5323:Dnah3 UTSW 7 119,620,234 (GRCm39) missense probably damaging 1.00
R5330:Dnah3 UTSW 7 119,542,871 (GRCm39) missense probably benign 0.00
R5385:Dnah3 UTSW 7 119,524,126 (GRCm39) missense probably damaging 1.00
R5391:Dnah3 UTSW 7 119,689,299 (GRCm39) missense probably benign 0.02
R5564:Dnah3 UTSW 7 119,570,689 (GRCm39) critical splice donor site probably null
R5594:Dnah3 UTSW 7 119,570,844 (GRCm39) missense possibly damaging 0.89
R5610:Dnah3 UTSW 7 119,538,288 (GRCm39) splice site probably null
R5673:Dnah3 UTSW 7 119,550,812 (GRCm39) missense possibly damaging 0.91
R5678:Dnah3 UTSW 7 119,677,074 (GRCm39) missense probably benign 0.00
R5737:Dnah3 UTSW 7 119,658,421 (GRCm39) missense probably benign 0.03
R5766:Dnah3 UTSW 7 119,577,445 (GRCm39) missense probably damaging 1.00
R5769:Dnah3 UTSW 7 119,689,175 (GRCm39) nonsense probably null
R5789:Dnah3 UTSW 7 119,542,822 (GRCm39) missense possibly damaging 0.70
R5791:Dnah3 UTSW 7 119,530,696 (GRCm39) missense probably benign 0.00
R5841:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5843:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5844:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5846:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5851:Dnah3 UTSW 7 119,638,585 (GRCm39) missense possibly damaging 0.51
R5853:Dnah3 UTSW 7 119,538,056 (GRCm39) missense probably damaging 1.00
R5857:Dnah3 UTSW 7 119,550,244 (GRCm39) utr 3 prime probably benign
R5865:Dnah3 UTSW 7 119,574,331 (GRCm39) missense probably benign 0.00
R5885:Dnah3 UTSW 7 119,668,927 (GRCm39) missense probably benign 0.10
R5898:Dnah3 UTSW 7 119,677,724 (GRCm39) missense probably benign 0.37
R5917:Dnah3 UTSW 7 119,615,749 (GRCm39) missense probably damaging 1.00
R5964:Dnah3 UTSW 7 119,522,103 (GRCm39) missense probably benign 0.00
R5990:Dnah3 UTSW 7 119,672,764 (GRCm39) missense probably benign
R6004:Dnah3 UTSW 7 119,685,520 (GRCm39) missense probably benign 0.10
R6033:Dnah3 UTSW 7 119,670,870 (GRCm39) missense probably benign 0.00
R6033:Dnah3 UTSW 7 119,670,870 (GRCm39) missense probably benign 0.00
R6045:Dnah3 UTSW 7 119,566,745 (GRCm39) missense probably damaging 0.99
R6056:Dnah3 UTSW 7 119,629,254 (GRCm39) missense probably damaging 1.00
R6133:Dnah3 UTSW 7 119,685,469 (GRCm39) missense probably benign 0.10
R6229:Dnah3 UTSW 7 119,564,711 (GRCm39) missense probably benign 0.11
R6237:Dnah3 UTSW 7 119,608,607 (GRCm39) missense probably damaging 1.00
R6333:Dnah3 UTSW 7 119,653,856 (GRCm39) missense probably damaging 1.00
R6408:Dnah3 UTSW 7 119,522,191 (GRCm39) splice site probably null
R6447:Dnah3 UTSW 7 119,522,277 (GRCm39) missense probably benign 0.12
R6606:Dnah3 UTSW 7 119,660,179 (GRCm39) missense probably benign 0.02
R6666:Dnah3 UTSW 7 119,670,172 (GRCm39) missense probably benign 0.16
R6733:Dnah3 UTSW 7 119,522,197 (GRCm39) missense probably benign 0.22
R6815:Dnah3 UTSW 7 119,570,950 (GRCm39) missense probably benign
R6882:Dnah3 UTSW 7 119,570,407 (GRCm39) missense possibly damaging 0.95
R6934:Dnah3 UTSW 7 119,653,824 (GRCm39) critical splice donor site probably null
R6966:Dnah3 UTSW 7 119,631,977 (GRCm39) missense probably damaging 1.00
R7025:Dnah3 UTSW 7 119,629,233 (GRCm39) missense possibly damaging 0.90
R7207:Dnah3 UTSW 7 119,570,312 (GRCm39) missense probably damaging 1.00
R7214:Dnah3 UTSW 7 119,521,965 (GRCm39) missense probably damaging 1.00
R7222:Dnah3 UTSW 7 119,670,746 (GRCm39) missense probably benign 0.00
R7235:Dnah3 UTSW 7 119,631,893 (GRCm39) missense probably damaging 1.00
R7241:Dnah3 UTSW 7 119,542,856 (GRCm39) missense probably benign 0.03
R7313:Dnah3 UTSW 7 119,580,567 (GRCm39) missense probably benign 0.39
R7342:Dnah3 UTSW 7 119,629,208 (GRCm39) missense probably damaging 1.00
R7368:Dnah3 UTSW 7 119,628,239 (GRCm39) missense probably benign
R7375:Dnah3 UTSW 7 119,550,900 (GRCm39) missense probably damaging 1.00
R7395:Dnah3 UTSW 7 119,660,183 (GRCm39) missense probably benign 0.00
R7431:Dnah3 UTSW 7 119,650,967 (GRCm39) missense probably damaging 1.00
R7499:Dnah3 UTSW 7 119,660,135 (GRCm39) missense probably damaging 0.99
R7515:Dnah3 UTSW 7 119,672,815 (GRCm39) missense probably benign 0.21
R7564:Dnah3 UTSW 7 119,570,817 (GRCm39) missense probably benign
R7618:Dnah3 UTSW 7 119,577,601 (GRCm39) missense probably damaging 0.97
R7697:Dnah3 UTSW 7 119,566,657 (GRCm39) missense
R7728:Dnah3 UTSW 7 119,538,051 (GRCm39) missense probably damaging 1.00
R7757:Dnah3 UTSW 7 119,570,438 (GRCm39) splice site probably null
R7757:Dnah3 UTSW 7 119,670,793 (GRCm39) missense probably benign
R7774:Dnah3 UTSW 7 119,550,975 (GRCm39) nonsense probably null
R7804:Dnah3 UTSW 7 119,610,235 (GRCm39) missense probably damaging 1.00
R7804:Dnah3 UTSW 7 119,551,841 (GRCm39) missense probably damaging 1.00
R7857:Dnah3 UTSW 7 119,550,927 (GRCm39) missense probably damaging 1.00
R7871:Dnah3 UTSW 7 119,566,775 (GRCm39) missense
R7903:Dnah3 UTSW 7 119,641,351 (GRCm39) missense probably damaging 1.00
R7927:Dnah3 UTSW 7 119,550,494 (GRCm39) missense probably damaging 0.97
R7989:Dnah3 UTSW 7 119,677,012 (GRCm39) missense probably benign
R8142:Dnah3 UTSW 7 119,660,189 (GRCm39) missense probably benign 0.00
R8164:Dnah3 UTSW 7 119,566,837 (GRCm39) missense probably damaging 1.00
R8237:Dnah3 UTSW 7 119,525,636 (GRCm39) missense probably benign 0.01
R8313:Dnah3 UTSW 7 119,550,375 (GRCm39) missense probably benign 0.38
R8338:Dnah3 UTSW 7 119,671,104 (GRCm39) missense probably benign 0.01
R8355:Dnah3 UTSW 7 119,551,431 (GRCm39) missense probably damaging 1.00
R8408:Dnah3 UTSW 7 119,551,728 (GRCm39) missense probably damaging 1.00
R8411:Dnah3 UTSW 7 119,610,253 (GRCm39) missense probably damaging 1.00
R8455:Dnah3 UTSW 7 119,551,431 (GRCm39) missense probably damaging 1.00
R8483:Dnah3 UTSW 7 119,536,253 (GRCm39) missense probably benign 0.00
R8531:Dnah3 UTSW 7 119,550,591 (GRCm39) missense probably damaging 1.00
R8885:Dnah3 UTSW 7 119,561,375 (GRCm39) missense
R8912:Dnah3 UTSW 7 119,689,869 (GRCm39) missense probably benign 0.06
R8966:Dnah3 UTSW 7 119,549,881 (GRCm39) nonsense probably null
R8982:Dnah3 UTSW 7 119,536,294 (GRCm39) missense probably damaging 1.00
R9043:Dnah3 UTSW 7 119,551,272 (GRCm39) missense probably benign
R9053:Dnah3 UTSW 7 119,618,987 (GRCm39) missense possibly damaging 0.67
R9059:Dnah3 UTSW 7 119,684,368 (GRCm39) missense probably benign 0.01
R9182:Dnah3 UTSW 7 119,684,351 (GRCm39) missense probably damaging 0.98
R9365:Dnah3 UTSW 7 119,566,859 (GRCm39) missense
R9383:Dnah3 UTSW 7 119,646,819 (GRCm39) missense probably benign 0.23
R9430:Dnah3 UTSW 7 119,628,205 (GRCm39) missense probably damaging 1.00
R9449:Dnah3 UTSW 7 119,551,473 (GRCm39) missense probably benign 0.12
R9462:Dnah3 UTSW 7 119,551,523 (GRCm39) missense probably benign 0.05
R9505:Dnah3 UTSW 7 119,644,912 (GRCm39) missense probably damaging 1.00
R9559:Dnah3 UTSW 7 119,650,951 (GRCm39) missense probably benign 0.07
R9562:Dnah3 UTSW 7 119,610,114 (GRCm39) missense probably benign 0.05
R9565:Dnah3 UTSW 7 119,610,114 (GRCm39) missense probably benign 0.05
R9609:Dnah3 UTSW 7 119,670,236 (GRCm39) missense probably damaging 0.98
R9622:Dnah3 UTSW 7 119,561,356 (GRCm39) missense
R9633:Dnah3 UTSW 7 119,550,216 (GRCm39) missense probably benign
R9654:Dnah3 UTSW 7 119,641,396 (GRCm39) nonsense probably null
R9665:Dnah3 UTSW 7 119,644,981 (GRCm39) missense probably benign 0.01
R9681:Dnah3 UTSW 7 119,677,611 (GRCm39) missense probably benign 0.04
R9717:Dnah3 UTSW 7 119,574,299 (GRCm39) missense probably damaging 1.00
Z1088:Dnah3 UTSW 7 119,610,096 (GRCm39) missense probably null 1.00
Z1088:Dnah3 UTSW 7 119,685,520 (GRCm39) missense probably benign 0.00
Z1176:Dnah3 UTSW 7 119,567,026 (GRCm39) missense
Z1177:Dnah3 UTSW 7 119,607,085 (GRCm39) missense probably benign
Z1177:Dnah3 UTSW 7 119,567,124 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAGCTTTCAGAGTGCAGAGTAC -3'
(R):5'- ATTCCCATTTACCAGCCAGAGG -3'

Sequencing Primer
(F):5'- TACAGATGCATGCCTGTGC -3'
(R):5'- GCATTGCCTGCCCCTTG -3'
Posted On 2019-09-13