Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Dnah3'

573741

Institutional Source

Beutler Lab

Gene Symbol

Dnah3

Ensembl Gene

ENSMUSG00000052273

Gene Name

dynein, axonemal, heavy chain 3

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119922671-120095280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119966251 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 169 (I169F)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046993] [ENSMUST00000209154] [ENSMUST00000213149]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046993
AA Change: I2556F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000042857
Gene: ENSMUSG00000052273
AA Change: I2556F

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	805	820	N/A	INTRINSIC
Pfam:DHC_N2	826	1235	3.3e-144	PFAM
AAA	1388	1527	1.59e-1	SMART
low complexity region	1594	1606	N/A	INTRINSIC
Blast:AAA	1669	1897	9e-84	BLAST
AAA	2033	2180	1.33e-3	SMART
Pfam:AAA_8	2362	2632	1.5e-63	PFAM
Pfam:MT	2644	2994	7.4e-52	PFAM
Pfam:AAA_9	3015	3240	3.5e-92	PFAM
low complexity region	3338	3349	N/A	INTRINSIC
Pfam:Dynein_heavy	3376	4079	4.4e-285	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000209154
AA Change: I2545F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000213149

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Dnah3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00650:Dnah3	APN	7	119938905	missense	possibly damaging	0.88
IGL01095:Dnah3	APN	7	119951597	missense	probably benign	0.02
IGL01329:Dnah3	APN	7	120022941	missense	probably damaging	1.00
IGL01380:Dnah3	APN	7	119926564	missense	probably damaging	1.00
IGL01410:Dnah3	APN	7	119967720	missense	possibly damaging	0.91
IGL01487:Dnah3	APN	7	119965530	nonsense	probably null
IGL01843:Dnah3	APN	7	119943575	missense	probably benign	0.12
IGL01929:Dnah3	APN	7	119951651	nonsense	probably null
IGL01994:Dnah3	APN	7	119951214	missense	possibly damaging	0.58
IGL02115:Dnah3	APN	7	120029054	missense	probably damaging	1.00
IGL02273:Dnah3	APN	7	119951271	missense	probably damaging	1.00
IGL02299:Dnah3	APN	7	119967579	missense	probably benign	0.39
IGL02421:Dnah3	APN	7	119950992	missense	possibly damaging	0.87
IGL02514:Dnah3	APN	7	119966247	missense	probably damaging	1.00
IGL02596:Dnah3	APN	7	119938914	missense	probably benign	0.19
IGL02716:Dnah3	APN	7	119937023	missense	probably damaging	0.97
IGL02738:Dnah3	APN	7	119965497	missense	probably benign
IGL03404:Dnah3	APN	7	119938977	missense	probably damaging	1.00
R0964_Dnah3_480	UTSW	7	119952739	splice site	probably benign
R1778_Dnah3_238	UTSW	7	120078402	missense	probably damaging	1.00
R4658_Dnah3_599	UTSW	7	119950651	missense	probably damaging	1.00
BB004:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
BB014:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R0011:Dnah3	UTSW	7	120019701	missense	probably damaging	1.00
R0195:Dnah3	UTSW	7	120077775	critical splice donor site	probably null
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0241:Dnah3	UTSW	7	119922730	missense	probably damaging	1.00
R0312:Dnah3	UTSW	7	120045659	missense	probably damaging	1.00
R0316:Dnah3	UTSW	7	119965659	missense	possibly damaging	0.94
R0370:Dnah3	UTSW	7	120086720	missense	possibly damaging	0.91
R0426:Dnah3	UTSW	7	119943572	missense	probably benign	0.11
R0525:Dnah3	UTSW	7	119928754	missense	probably damaging	1.00
R0625:Dnah3	UTSW	7	120071887	missense	possibly damaging	0.68
R0627:Dnah3	UTSW	7	120020915	missense	probably damaging	1.00
R0632:Dnah3	UTSW	7	119967905	missense	probably benign	0.11
R0928:Dnah3	UTSW	7	120030051	missense	probably damaging	1.00
R0964:Dnah3	UTSW	7	119952739	splice site	probably benign
R0972:Dnah3	UTSW	7	120035340	splice site	probably null
R1066:Dnah3	UTSW	7	120061009	missense	probably damaging	1.00
R1082:Dnah3	UTSW	7	120078445	missense	probably damaging	1.00
R1127:Dnah3	UTSW	7	119923030	missense	probably damaging	1.00
R1132:Dnah3	UTSW	7	119939004	missense	possibly damaging	0.50
R1222:Dnah3	UTSW	7	120090676	missense	probably benign	0.28
R1420:Dnah3	UTSW	7	119951979	missense	probably damaging	0.99
R1456:Dnah3	UTSW	7	120047630	missense	probably damaging	1.00
R1472:Dnah3	UTSW	7	120070958	missense	probably benign	0.12
R1617:Dnah3	UTSW	7	120089946	missense	probably benign	0.01
R1624:Dnah3	UTSW	7	120019695	missense	probably damaging	0.99
R1654:Dnah3	UTSW	7	119926449	missense	probably damaging	1.00
R1673:Dnah3	UTSW	7	119971179	nonsense	probably null
R1677:Dnah3	UTSW	7	119928740	missense	probably damaging	1.00
R1687:Dnah3	UTSW	7	120045786	splice site	probably null
R1711:Dnah3	UTSW	7	120078571	missense	probably damaging	1.00
R1738:Dnah3	UTSW	7	120035359	missense	probably damaging	1.00
R1778:Dnah3	UTSW	7	120078402	missense	probably damaging	1.00
R1866:Dnah3	UTSW	7	119928856	splice site	probably null
R1883:Dnah3	UTSW	7	120077919	missense	probably benign	0.06
R1894:Dnah3	UTSW	7	120086334	missense	probably benign	0.05
R1929:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R1988:Dnah3	UTSW	7	119967570	missense	possibly damaging	0.92
R1988:Dnah3	UTSW	7	119967959	missense	probably damaging	0.99
R2010:Dnah3	UTSW	7	120095177	start codon destroyed	probably benign	0.00
R2022:Dnah3	UTSW	7	119951242	missense	probably damaging	1.00
R2026:Dnah3	UTSW	7	120039406	missense	probably damaging	1.00
R2063:Dnah3	UTSW	7	119951909	missense	probably damaging	0.96
R2131:Dnah3	UTSW	7	119967759	missense	possibly damaging	0.93
R2152:Dnah3	UTSW	7	119952013	missense	probably benign	0.02
R2199:Dnah3	UTSW	7	119951569	missense	possibly damaging	0.89
R2271:Dnah3	UTSW	7	119975129	missense	probably benign	0.10
R2350:Dnah3	UTSW	7	120045788	splice site	probably null
R2567:Dnah3	UTSW	7	119952697	missense	possibly damaging	0.83
R2848:Dnah3	UTSW	7	119967938	missense	probably benign	0.01
R2902:Dnah3	UTSW	7	119951499	missense	possibly damaging	0.61
R2926:Dnah3	UTSW	7	119951115	missense	probably damaging	1.00
R2944:Dnah3	UTSW	7	119951110	missense	probably damaging	1.00
R3022:Dnah3	UTSW	7	120078481	missense	possibly damaging	0.93
R3401:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3402:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3403:Dnah3	UTSW	7	119967656	missense	probably benign	0.00
R3919:Dnah3	UTSW	7	119951080	missense	probably damaging	1.00
R3972:Dnah3	UTSW	7	120086720	missense	probably damaging	0.99
R4162:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4184:Dnah3	UTSW	7	120083293	missense	probably damaging	1.00
R4198:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4199:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4200:Dnah3	UTSW	7	119922838	missense	probably damaging	1.00
R4239:Dnah3	UTSW	7	120029025	nonsense	probably null
R4478:Dnah3	UTSW	7	120071863	missense	probably benign	0.00
R4579:Dnah3	UTSW	7	120009331	missense	probably damaging	1.00
R4600:Dnah3	UTSW	7	120089946	missense	probably benign
R4649:Dnah3	UTSW	7	120047698	missense	probably damaging	1.00
R4658:Dnah3	UTSW	7	119950651	missense	probably damaging	1.00
R4728:Dnah3	UTSW	7	120059366	missense	probably damaging	0.99
R4739:Dnah3	UTSW	7	120077946	missense	possibly damaging	0.54
R4758:Dnah3	UTSW	7	120079406	missense	probably benign	0.00
R4785:Dnah3	UTSW	7	119967824	missense	probably benign	0.29
R4789:Dnah3	UTSW	7	120011072	missense	probably damaging	1.00
R4930:Dnah3	UTSW	7	119951681	nonsense	probably null
R4935:Dnah3	UTSW	7	120016477	nonsense	probably null
R4946:Dnah3	UTSW	7	119931560	missense	probably damaging	1.00
R4981:Dnah3	UTSW	7	119956201	missense	probably benign	0.03
R4984:Dnah3	UTSW	7	119928779	missense	probably benign	0.04
R5025:Dnah3	UTSW	7	120071905	missense	probably benign	0.02
R5046:Dnah3	UTSW	7	119951580	missense	probably damaging	1.00
R5056:Dnah3	UTSW	7	120020946	missense	probably damaging	1.00
R5068:Dnah3	UTSW	7	120032790	missense	probably benign
R5069:Dnah3	UTSW	7	120032790	missense	probably benign
R5154:Dnah3	UTSW	7	119952419	missense	probably damaging	1.00
R5208:Dnah3	UTSW	7	120032638	missense	probably damaging	1.00
R5323:Dnah3	UTSW	7	120021011	missense	probably damaging	1.00
R5330:Dnah3	UTSW	7	119943648	missense	probably benign	0.00
R5385:Dnah3	UTSW	7	119924903	missense	probably damaging	1.00
R5391:Dnah3	UTSW	7	120090076	missense	probably benign	0.02
R5564:Dnah3	UTSW	7	119971466	critical splice donor site	probably null
R5594:Dnah3	UTSW	7	119971621	missense	possibly damaging	0.89
R5610:Dnah3	UTSW	7	119939065	splice site	probably null
R5673:Dnah3	UTSW	7	119951589	missense	possibly damaging	0.91
R5678:Dnah3	UTSW	7	120077851	missense	probably benign	0.00
R5737:Dnah3	UTSW	7	120059198	missense	probably benign	0.03
R5766:Dnah3	UTSW	7	119978222	missense	probably damaging	1.00
R5769:Dnah3	UTSW	7	120089952	nonsense	probably null
R5789:Dnah3	UTSW	7	119943599	missense	possibly damaging	0.70
R5791:Dnah3	UTSW	7	119931473	missense	probably benign	0.00
R5841:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5843:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5844:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5846:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5851:Dnah3	UTSW	7	120039362	missense	possibly damaging	0.51
R5853:Dnah3	UTSW	7	119938833	missense	probably damaging	1.00
R5857:Dnah3	UTSW	7	119951021	utr 3 prime	probably benign
R5865:Dnah3	UTSW	7	119975108	missense	probably benign	0.00
R5885:Dnah3	UTSW	7	120069704	missense	probably benign	0.10
R5898:Dnah3	UTSW	7	120078501	missense	probably benign	0.37
R5917:Dnah3	UTSW	7	120016526	missense	probably damaging	1.00
R5964:Dnah3	UTSW	7	119922880	missense	probably benign	0.00
R5990:Dnah3	UTSW	7	120073541	missense	probably benign
R6004:Dnah3	UTSW	7	120086297	missense	probably benign	0.10
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6033:Dnah3	UTSW	7	120071647	missense	probably benign	0.00
R6045:Dnah3	UTSW	7	119967522	missense	probably damaging	0.99
R6056:Dnah3	UTSW	7	120030031	missense	probably damaging	1.00
R6133:Dnah3	UTSW	7	120086246	missense	probably benign	0.10
R6229:Dnah3	UTSW	7	119965488	missense	probably benign	0.11
R6237:Dnah3	UTSW	7	120009384	missense	probably damaging	1.00
R6333:Dnah3	UTSW	7	120054633	missense	probably damaging	1.00
R6408:Dnah3	UTSW	7	119922968	splice site	probably null
R6447:Dnah3	UTSW	7	119923054	missense	probably benign	0.12
R6606:Dnah3	UTSW	7	120060956	missense	probably benign	0.02
R6666:Dnah3	UTSW	7	120070949	missense	probably benign	0.16
R6733:Dnah3	UTSW	7	119922974	missense	probably benign	0.22
R6815:Dnah3	UTSW	7	119971727	missense	probably benign
R6882:Dnah3	UTSW	7	119971184	missense	possibly damaging	0.95
R6934:Dnah3	UTSW	7	120054601	critical splice donor site	probably null
R6966:Dnah3	UTSW	7	120032754	missense	probably damaging	1.00
R7025:Dnah3	UTSW	7	120030010	missense	possibly damaging	0.90
R7207:Dnah3	UTSW	7	119971089	missense	probably damaging	1.00
R7214:Dnah3	UTSW	7	119922742	missense	probably damaging	1.00
R7222:Dnah3	UTSW	7	120071523	missense	probably benign	0.00
R7235:Dnah3	UTSW	7	120032670	missense	probably damaging	1.00
R7241:Dnah3	UTSW	7	119943633	missense	probably benign	0.03
R7313:Dnah3	UTSW	7	119981344	missense	probably benign	0.39
R7342:Dnah3	UTSW	7	120029985	missense	probably damaging	1.00
R7368:Dnah3	UTSW	7	120029016	missense	probably benign
R7375:Dnah3	UTSW	7	119951677	missense	probably damaging	1.00
R7395:Dnah3	UTSW	7	120060960	missense	probably benign	0.00
R7431:Dnah3	UTSW	7	120051744	missense	probably damaging	1.00
R7499:Dnah3	UTSW	7	120060912	missense	probably damaging	0.99
R7515:Dnah3	UTSW	7	120073592	missense	probably benign	0.21
R7564:Dnah3	UTSW	7	119971594	missense	probably benign
R7618:Dnah3	UTSW	7	119978378	missense	probably damaging	0.97
R7697:Dnah3	UTSW	7	119967434	missense
R7728:Dnah3	UTSW	7	119938828	missense	probably damaging	1.00
R7757:Dnah3	UTSW	7	119971215	splice site	probably null
R7757:Dnah3	UTSW	7	120071570	missense	probably benign
R7774:Dnah3	UTSW	7	119951752	nonsense	probably null
R7804:Dnah3	UTSW	7	119952618	missense	probably damaging	1.00
R7804:Dnah3	UTSW	7	120011012	missense	probably damaging	1.00
R7857:Dnah3	UTSW	7	119951704	missense	probably damaging	1.00
R7871:Dnah3	UTSW	7	119967552	missense
R7903:Dnah3	UTSW	7	120042128	missense	probably damaging	1.00
R7927:Dnah3	UTSW	7	119951271	missense	probably damaging	0.97
R7989:Dnah3	UTSW	7	120077789	missense	probably benign
R8142:Dnah3	UTSW	7	120060966	missense	probably benign	0.00
R8164:Dnah3	UTSW	7	119967614	missense	probably damaging	1.00
R8237:Dnah3	UTSW	7	119926413	missense	probably benign	0.01
R8313:Dnah3	UTSW	7	119951152	missense	probably benign	0.38
R8338:Dnah3	UTSW	7	120071881	missense	probably benign	0.01
R8355:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8408:Dnah3	UTSW	7	119952505	missense	probably damaging	1.00
R8411:Dnah3	UTSW	7	120011030	missense	probably damaging	1.00
R8455:Dnah3	UTSW	7	119952208	missense	probably damaging	1.00
R8483:Dnah3	UTSW	7	119937030	missense	probably benign	0.00
R8531:Dnah3	UTSW	7	119951368	missense	probably damaging	1.00
R8885:Dnah3	UTSW	7	119962152	missense
R8912:Dnah3	UTSW	7	120090646	missense	probably benign	0.06
R8966:Dnah3	UTSW	7	119950658	nonsense	probably null
R8982:Dnah3	UTSW	7	119937071	missense	probably damaging	1.00
R9043:Dnah3	UTSW	7	119952049	missense	probably benign
R9053:Dnah3	UTSW	7	120019764	missense	possibly damaging	0.67
R9059:Dnah3	UTSW	7	120085145	missense	probably benign	0.01
R9182:Dnah3	UTSW	7	120085128	missense	probably damaging	0.98
R9365:Dnah3	UTSW	7	119967636	missense
R9383:Dnah3	UTSW	7	120047596	missense	probably benign	0.23
R9430:Dnah3	UTSW	7	120028982	missense	probably damaging	1.00
R9449:Dnah3	UTSW	7	119952250	missense	probably benign	0.12
R9462:Dnah3	UTSW	7	119952300	missense	probably benign	0.05
R9505:Dnah3	UTSW	7	120045689	missense	probably damaging	1.00
R9559:Dnah3	UTSW	7	120051728	missense	probably benign	0.07
R9562:Dnah3	UTSW	7	120010891	missense	probably benign	0.05
R9565:Dnah3	UTSW	7	120010891	missense	probably benign	0.05
R9609:Dnah3	UTSW	7	120071013	missense	probably damaging	0.98
R9622:Dnah3	UTSW	7	119962133	missense
R9633:Dnah3	UTSW	7	119950993	missense	probably benign
R9654:Dnah3	UTSW	7	120042173	nonsense	probably null
R9665:Dnah3	UTSW	7	120045758	missense	probably benign	0.01
R9681:Dnah3	UTSW	7	120078388	missense	probably benign	0.04
R9717:Dnah3	UTSW	7	119975076	missense	probably damaging	1.00
Z1088:Dnah3	UTSW	7	120010873	missense	probably null	1.00
Z1088:Dnah3	UTSW	7	120086297	missense	probably benign	0.00
Z1176:Dnah3	UTSW	7	119967803	missense
Z1177:Dnah3	UTSW	7	119967901	missense	probably damaging	0.99
Z1177:Dnah3	UTSW	7	120007862	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGCTTTCAGAGTGCAGAGTAC -3'
(R):5'- ATTCCCATTTACCAGCCAGAGG -3'

Sequencing Primer
(F):5'- TACAGATGCATGCCTGTGC -3'
(R):5'- GCATTGCCTGCCCCTTG -3'

Posted On

2019-09-13