Incidental Mutation 'R7395:Ces2a'
ID 573745
Institutional Source Beutler Lab
Gene Symbol Ces2a
Ensembl Gene ENSMUSG00000055730
Gene Name carboxylesterase 2A
Synonyms Ces6, 9130231C15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7395 (G1)
Quality Score 155.008
Status Validated
Chromosome 8
Chromosomal Location 104734003-104741634 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 104739641 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 390 (E390G)
Ref Sequence ENSEMBL: ENSMUSP00000034346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034346] [ENSMUST00000161824] [ENSMUST00000164182]
AlphaFold Q8QZR3
Predicted Effect probably benign
Transcript: ENSMUST00000034346
AA Change: E390G

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034346
Gene: ENSMUSG00000055730
AA Change: E390G

DomainStartEndE-ValueType
Pfam:COesterase 9 537 1.2e-171 PFAM
Pfam:Abhydrolase_3 142 267 2.9e-11 PFAM
Pfam:Peptidase_S9 156 347 7e-8 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000161824
Predicted Effect probably benign
Transcript: ENSMUST00000164182
AA Change: E357G

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127346
Gene: ENSMUSG00000055730
AA Change: E357G

DomainStartEndE-ValueType
Pfam:COesterase 8 276 5e-110 PFAM
Pfam:Abhydrolase_3 142 267 2.6e-11 PFAM
Pfam:Peptidase_S9 156 275 3e-7 PFAM
Pfam:COesterase 259 504 8.3e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
4930433I11Rik A T 7: 40,989,678 T13S probably damaging Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
B3glct A G 5: 149,725,604 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 254 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dcun1d2 G A 8: 13,278,675 R75* probably null Het
Defb19 A T 2: 152,580,023 probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tcstv1 A T 13: 119,894,130 probably null Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Tph1 C T 7: 46,657,203 probably null Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Ulk4 T A 9: 121,255,112 Q129L probably benign Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Ces2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:Ces2a APN 8 104741415 makesense probably null
IGL02135:Ces2a APN 8 104740181 missense probably benign 0.00
IGL02529:Ces2a APN 8 104737219 splice site probably benign
IGL02625:Ces2a APN 8 104740278 critical splice donor site probably null
IGL02869:Ces2a APN 8 104739059 missense probably damaging 1.00
IGL03265:Ces2a APN 8 104737443 missense possibly damaging 0.55
IGL03349:Ces2a APN 8 104734080 missense probably damaging 0.99
R0010:Ces2a UTSW 8 104741396 missense probably benign 0.00
R0318:Ces2a UTSW 8 104740824 missense probably damaging 1.00
R0477:Ces2a UTSW 8 104737537 missense probably damaging 0.99
R0561:Ces2a UTSW 8 104737533 missense probably benign 0.35
R0619:Ces2a UTSW 8 104736110 missense probably benign 0.00
R1665:Ces2a UTSW 8 104737555 splice site probably benign
R1737:Ces2a UTSW 8 104740824 missense probably damaging 0.98
R2266:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2267:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2269:Ces2a UTSW 8 104740190 missense probably benign 0.02
R2288:Ces2a UTSW 8 104737437 missense probably damaging 1.00
R2656:Ces2a UTSW 8 104736134 missense probably benign 0.00
R3176:Ces2a UTSW 8 104739378 splice site probably benign
R3906:Ces2a UTSW 8 104739308 missense probably benign 0.00
R4344:Ces2a UTSW 8 104737134 missense probably damaging 1.00
R4708:Ces2a UTSW 8 104737306 missense probably benign 0.14
R4780:Ces2a UTSW 8 104737208 missense probably damaging 1.00
R5434:Ces2a UTSW 8 104737409 missense probably damaging 0.98
R5763:Ces2a UTSW 8 104736124 missense probably benign 0.00
R5828:Ces2a UTSW 8 104739324 missense probably benign 0.00
R6359:Ces2a UTSW 8 104736078 missense probably benign 0.00
R6440:Ces2a UTSW 8 104741322 missense probably benign 0.12
R7066:Ces2a UTSW 8 104740248 missense probably damaging 0.99
R7267:Ces2a UTSW 8 104739040 missense probably benign 0.20
R7455:Ces2a UTSW 8 104737522 missense probably damaging 1.00
R7457:Ces2a UTSW 8 104737389 missense possibly damaging 0.87
R7567:Ces2a UTSW 8 104741298 missense probably benign 0.01
R7683:Ces2a UTSW 8 104737112 missense probably benign 0.00
R8328:Ces2a UTSW 8 104737366 missense probably damaging 1.00
R8336:Ces2a UTSW 8 104739033 missense probably damaging 0.97
R9183:Ces2a UTSW 8 104734142 missense possibly damaging 0.95
R9794:Ces2a UTSW 8 104741264 missense probably benign 0.16
X0022:Ces2a UTSW 8 104736142 missense probably damaging 1.00
Z1176:Ces2a UTSW 8 104734006 unclassified probably benign
Z1176:Ces2a UTSW 8 104734850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTCCCAGATAACATGCCCAG -3'
(R):5'- TCCAGAGCTTACATGGGTCC -3'

Sequencing Primer
(F):5'- CCCAGAAATAAAGTGTGTGTGTGTG -3'
(R):5'- AGAGCTTACATGGGTCCCACAG -3'
Posted On 2019-09-13