Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:St14'

573749

Institutional Source

Beutler Lab

Gene Symbol

St14

Ensembl Gene

ENSMUSG00000031995

Gene Name

suppression of tumorigenicity 14 (colon carcinoma)

Synonyms

MT-SP1, matriptase, Tmprss14, Prss14, Epithin

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

31089402-31131853 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 31096899 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Glutamic Acid at position 547 (K547E)

Ref Sequence

ENSEMBL: ENSMUSP00000034478 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034478]

AlphaFold

P56677

Predicted Effect

probably benign
Transcript: ENSMUST00000034478
AA Change: K547E

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000034478
Gene: ENSMUSG00000031995
AA Change: K547E

Domain	Start	End	E-Value	Type
transmembrane domain	55	77	N/A	INTRINSIC
Pfam:SEA	88	181	7.9e-17	PFAM
CUB	214	334	4.24e-14	SMART
CUB	340	447	4.37e-25	SMART
LDLa	452	486	2.31e-9	SMART
LDLa	487	523	4.08e-10	SMART
LDLa	524	561	3.98e-13	SMART
LDLa	566	604	1.48e-7	SMART
Tryp_SPc	614	849	1.25e-93	SMART

Meta Mutation Damage Score

0.1368

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this locus results in pleiotropic defects affecting the development of the epidermis, hair follicles, and immune system. Mutant mice become dehydrated due to impaired epidermal barrier function and die within days of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in St14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00781:St14	APN	9	31103779	missense	probably damaging	1.00
IGL01443:St14	APN	9	31100193	nonsense	probably null
IGL01816:St14	APN	9	31108267	missense	possibly damaging	0.71
IGL02100:St14	APN	9	31100130	splice site	probably benign
IGL02494:St14	APN	9	31108645	missense	possibly damaging	0.47
IGL02588:St14	APN	9	31090033	splice site	probably benign
IGL02663:St14	APN	9	31100382	splice site	probably null
IGL02711:St14	APN	9	31089900	missense	probably benign	0.05
IGL03130:St14	APN	9	31097071	critical splice donor site	probably null
IGL03296:St14	APN	9	31108712	missense	probably damaging	0.98
IGL03400:St14	APN	9	31096971	splice site	probably benign
R0101:St14	UTSW	9	31097107	missense	probably benign	0.23
R0225:St14	UTSW	9	31108284	critical splice acceptor site	probably null
R0335:St14	UTSW	9	31091324	splice site	probably benign
R0892:St14	UTSW	9	31100428	missense	probably benign	0.38
R1334:St14	UTSW	9	31108210	missense	probably damaging	1.00
R1487:St14	UTSW	9	31097180	missense	probably damaging	1.00
R1521:St14	UTSW	9	31108215	missense	probably benign	0.03
R1782:St14	UTSW	9	31100164	missense	probably damaging	1.00
R1920:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1921:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1922:St14	UTSW	9	31089870	missense	possibly damaging	0.94
R1933:St14	UTSW	9	31106212	missense	probably benign	0.00
R2070:St14	UTSW	9	31091373	missense	probably damaging	1.00
R2411:St14	UTSW	9	31108234	missense	probably benign	0.13
R4152:St14	UTSW	9	31090506	missense	probably benign	0.08
R4375:St14	UTSW	9	31090458	missense	probably benign	0.02
R4419:St14	UTSW	9	31096928	missense	probably damaging	1.00
R4747:St14	UTSW	9	31103757	missense	possibly damaging	0.78
R4791:St14	UTSW	9	31095622	missense	probably benign	0.27
R4915:St14	UTSW	9	31108664	nonsense	probably null
R5056:St14	UTSW	9	31097551	splice site	probably null
R5134:St14	UTSW	9	31095583	missense	probably benign	0.00
R5241:St14	UTSW	9	31100418	nonsense	probably null
R5325:St14	UTSW	9	31096978	splice site	probably null
R5644:St14	UTSW	9	31106510	missense	probably benign
R5828:St14	UTSW	9	31091507	missense	probably damaging	1.00
R5922:St14	UTSW	9	31129904	intron	probably benign
R5930:St14	UTSW	9	31103760	missense	probably damaging	1.00
R5963:St14	UTSW	9	31106557	intron	probably benign
R6911:St14	UTSW	9	31106785	missense	probably benign	0.00
R6937:St14	UTSW	9	31129660	splice site	probably null
R6986:St14	UTSW	9	31096549	missense	probably damaging	0.98
R7226:St14	UTSW	9	31100152	missense	possibly damaging	0.63
R7400:St14	UTSW	9	31108275	missense	probably benign	0.36
R8194:St14	UTSW	9	31131625	start codon destroyed	probably null	0.95
R8886:St14	UTSW	9	31097124	missense	possibly damaging	0.93
R9248:St14	UTSW	9	31091609	missense	probably damaging	1.00
R9440:St14	UTSW	9	31096549	missense	probably damaging	0.98
Z1177:St14	UTSW	9	31090507	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TTCTCCCCAGACTTAATACACAGG -3'
(R):5'- ACAGTGTCAACGACTGTGGG -3'

Sequencing Primer
(F):5'- ACACAGGAGACTTGGGTTTGTAATC -3'
(R):5'- AGGGCTGCAGTGAGTACC -3'

Posted On

2019-09-13