Incidental Mutation 'R7395:Dscaml1'
ID 573750
Institutional Source Beutler Lab
Gene Symbol Dscaml1
Ensembl Gene ENSMUSG00000032087
Gene Name DS cell adhesion molecule like 1
Synonyms 4921507G06Rik, 4930435C18Rik
MMRRC Submission 045477-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.481) question?
Stock # R7395 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 45338735-45665011 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 45613703 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 939 (Q939K)
Ref Sequence ENSEMBL: ENSMUSP00000034592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034592]
AlphaFold Q4VA61
Predicted Effect possibly damaging
Transcript: ENSMUST00000034592
AA Change: Q939K

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087
AA Change: Q939K

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 55 N/A INTRINSIC
IG_like 96 168 1.22e0 SMART
IG 189 277 1.15e-3 SMART
IGc2 296 359 2.54e-14 SMART
IGc2 385 451 8.12e-13 SMART
IGc2 478 550 9.55e-10 SMART
IGc2 575 640 9.78e-7 SMART
IGc2 666 734 5.93e-6 SMART
IGc2 760 832 6.75e-10 SMART
IG 853 943 1e-3 SMART
FN3 945 1029 6.64e-7 SMART
FN3 1045 1133 9.46e-12 SMART
FN3 1148 1234 3.2e-9 SMART
FN3 1249 1332 3.48e-10 SMART
IGc2 1363 1428 1.49e-11 SMART
FN3 1442 1522 3.42e-9 SMART
FN3 1537 1618 2.14e-1 SMART
low complexity region 1671 1683 N/A INTRINSIC
low complexity region 2018 2026 N/A INTRINSIC
low complexity region 2035 2069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216685
Meta Mutation Damage Score 0.1049 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 55,184,140 (GRCm39) probably null Het
4930433I11Rik A T 7: 40,639,102 (GRCm39) T13S probably damaging Het
Abca13 A G 11: 9,241,658 (GRCm39) I1174V probably benign Het
Acoxl G A 2: 127,726,336 (GRCm39) V237M probably damaging Het
Adam33 A C 2: 130,903,089 (GRCm39) W52G probably benign Het
Adgrv1 T C 13: 81,707,467 (GRCm39) H1313R probably damaging Het
Ap3d1 T C 10: 80,566,716 (GRCm39) T89A probably benign Het
Armc8 T C 9: 99,415,185 (GRCm39) E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,949 (GRCm39) *383Q probably null Het
Atp8b4 A T 2: 126,217,614 (GRCm39) L634Q possibly damaging Het
B3glct A G 5: 149,649,069 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Bicd2 A G 13: 49,531,706 (GRCm39) D316G possibly damaging Het
Bop1 A T 15: 76,338,041 (GRCm39) S610T probably damaging Het
Car11 T A 7: 45,350,745 (GRCm39) Y80* probably null Het
Ccdc121rt2 A T 5: 112,598,035 (GRCm39) E194V possibly damaging Het
Ccdc96 T C 5: 36,642,609 (GRCm39) I205T probably benign Het
Ces2a A G 8: 105,466,273 (GRCm39) E390G probably benign Het
Cfap54 C A 10: 92,720,565 (GRCm39) V2630L unknown Het
Chek2 G T 5: 111,019,974 (GRCm39) probably null Het
Cntn3 C T 6: 102,314,355 (GRCm39) probably null Het
Cpne3 A T 4: 19,528,239 (GRCm39) D339E probably damaging Het
Crocc2 C T 1: 93,143,829 (GRCm39) Q1403* probably null Het
Crppa A T 12: 36,551,994 (GRCm39) I283F possibly damaging Het
Csnka2ip G A 16: 64,299,803 (GRCm39) T187I Het
Ctu1 A G 7: 43,326,019 (GRCm39) H226R possibly damaging Het
Cubn G T 2: 13,291,875 (GRCm39) Q3317K probably damaging Het
Cyp17a1 A G 19: 46,659,134 (GRCm39) L169P probably benign Het
Dcc T A 18: 71,507,640 (GRCm39) K911* probably null Het
Dcun1d2 G A 8: 13,328,675 (GRCm39) R75* probably null Het
Defb19 A T 2: 152,421,943 (GRCm39) probably null Het
Dffb A T 4: 154,053,570 (GRCm39) S257R probably damaging Het
Dip2c A C 13: 9,664,413 (GRCm39) N942T probably damaging Het
Dnah3 T A 7: 119,565,474 (GRCm39) I169F Het
Dnah3 T C 7: 119,660,183 (GRCm39) M830V probably benign Het
Dnajc5g G A 5: 31,269,009 (GRCm39) S130N possibly damaging Het
Evpl G C 11: 116,117,905 (GRCm39) N761K possibly damaging Het
Fbxw8 A T 5: 118,206,280 (GRCm39) I556N probably damaging Het
Fry G T 5: 150,304,348 (GRCm39) M579I possibly damaging Het
Ggt7 A T 2: 155,337,800 (GRCm39) M488K probably benign Het
Gnpnat1 T A 14: 45,619,038 (GRCm39) H107L probably benign Het
Golga2 C A 2: 32,195,599 (GRCm39) P798Q possibly damaging Het
Gpr35 G A 1: 92,910,929 (GRCm39) A214T probably damaging Het
Greb1 A T 12: 16,759,431 (GRCm39) probably null Het
Hdac10 G A 15: 89,012,487 (GRCm39) T32I probably benign Het
Hkdc1 G A 10: 62,221,478 (GRCm39) T860I probably damaging Het
Icam5 C A 9: 20,946,738 (GRCm39) P422Q possibly damaging Het
Ist1 A C 8: 110,404,159 (GRCm39) S238A probably benign Het
Lrig2 T C 3: 104,404,836 (GRCm39) N91D probably benign Het
Mapt A C 11: 104,218,949 (GRCm39) D352A probably damaging Het
Micall2 G A 5: 139,702,124 (GRCm39) P373L possibly damaging Het
Mocs1 A G 17: 49,761,585 (GRCm39) S560G possibly damaging Het
Mpo A G 11: 87,691,950 (GRCm39) D461G probably damaging Het
Myo1a G T 10: 127,546,309 (GRCm39) V271L probably damaging Het
Ncoa1 G A 12: 4,345,188 (GRCm39) P720S not run Het
Ncr1 T A 7: 4,341,150 (GRCm39) I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 (GRCm39) R66C probably damaging Het
Obox5 A T 7: 15,492,668 (GRCm39) S208C probably damaging Het
Or10q1 T C 19: 13,726,502 (GRCm39) S11P probably damaging Het
Or2n1d A T 17: 38,646,755 (GRCm39) K236* probably null Het
Or5p75-ps1 T A 7: 108,107,611 (GRCm39) F116Y unknown Het
Or7d9 T A 9: 20,197,826 (GRCm39) M285K probably damaging Het
Padi4 A C 4: 140,488,983 (GRCm39) V152G probably damaging Het
Pdzd7 A T 19: 45,025,450 (GRCm39) D348E probably damaging Het
Pdzph1 T A 17: 59,186,154 (GRCm39) K1212N possibly damaging Het
Piezo2 C T 18: 63,160,634 (GRCm39) G2341R probably damaging Het
Plb1 A G 5: 32,511,028 (GRCm39) K1298E probably benign Het
Prr14l A G 5: 32,985,982 (GRCm39) L1171P probably benign Het
Rab11fip5 T C 6: 85,318,850 (GRCm39) T680A probably benign Het
Rev1 A T 1: 38,127,146 (GRCm39) N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Ryr2 A G 13: 11,799,997 (GRCm39) C917R probably damaging Het
Sall1 A T 8: 89,757,549 (GRCm39) S852T possibly damaging Het
Serpine2 A G 1: 79,779,272 (GRCm39) F296L probably damaging Het
Slc12a6 A T 2: 112,182,887 (GRCm39) N754I probably damaging Het
Slc39a6 A T 18: 24,718,332 (GRCm39) L575Q probably damaging Het
Smarcc2 T A 10: 128,321,475 (GRCm39) L890Q probably damaging Het
Smg5 T A 3: 88,268,378 (GRCm39) V1006D probably damaging Het
Ssh2 T C 11: 77,283,899 (GRCm39) V51A probably damaging Het
St14 T C 9: 31,008,195 (GRCm39) K547E probably benign Het
Stag1 T G 9: 100,678,781 (GRCm39) V234G probably damaging Het
Stag3 A T 5: 138,280,207 (GRCm39) Q24L probably benign Het
Stra6 T C 9: 58,048,380 (GRCm39) Y158H probably damaging Het
Tcstv1a A T 13: 120,355,666 (GRCm39) probably null Het
Tmem196 G A 12: 119,975,002 (GRCm39) C62Y probably damaging Het
Tmem265 T A 7: 127,164,039 (GRCm39) F84L Het
Tph1 C T 7: 46,306,627 (GRCm39) probably null Het
Ttn A G 2: 76,776,834 (GRCm39) I1522T unknown Het
Ulk4 T A 9: 121,084,178 (GRCm39) Q129L probably benign Het
Usp17la T A 7: 104,510,792 (GRCm39) S466T probably benign Het
Vmn2r31 A T 7: 7,387,744 (GRCm39) V609E probably damaging Het
Vmn2r52 C T 7: 9,904,744 (GRCm39) C365Y probably benign Het
Zbtb4 A T 11: 69,666,937 (GRCm39) T81S possibly damaging Het
Zfp605 A T 5: 110,259,885 (GRCm39) probably benign Het
Other mutations in Dscaml1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Dscaml1 APN 9 45,581,498 (GRCm39) nonsense probably null
IGL00497:Dscaml1 APN 9 45,663,536 (GRCm39) missense probably damaging 1.00
IGL00895:Dscaml1 APN 9 45,662,551 (GRCm39) missense probably damaging 0.99
IGL01011:Dscaml1 APN 9 45,594,970 (GRCm39) missense possibly damaging 0.76
IGL01086:Dscaml1 APN 9 45,613,960 (GRCm39) splice site probably benign
IGL01125:Dscaml1 APN 9 45,660,930 (GRCm39) critical splice acceptor site probably null
IGL01132:Dscaml1 APN 9 45,663,626 (GRCm39) nonsense probably null
IGL01356:Dscaml1 APN 9 45,658,155 (GRCm39) missense probably benign 0.03
IGL01459:Dscaml1 APN 9 45,653,981 (GRCm39) nonsense probably null
IGL01552:Dscaml1 APN 9 45,359,206 (GRCm39) missense probably damaging 1.00
IGL02033:Dscaml1 APN 9 45,595,080 (GRCm39) missense probably damaging 1.00
IGL02044:Dscaml1 APN 9 45,658,241 (GRCm39) nonsense probably null
IGL02095:Dscaml1 APN 9 45,359,001 (GRCm39) missense probably damaging 1.00
IGL02166:Dscaml1 APN 9 45,594,999 (GRCm39) missense probably damaging 0.98
IGL02262:Dscaml1 APN 9 45,643,378 (GRCm39) missense probably benign 0.44
IGL02262:Dscaml1 APN 9 45,656,414 (GRCm39) missense probably benign
IGL02340:Dscaml1 APN 9 45,581,474 (GRCm39) missense possibly damaging 0.66
IGL02604:Dscaml1 APN 9 45,655,626 (GRCm39) unclassified probably benign
IGL02619:Dscaml1 APN 9 45,359,094 (GRCm39) missense probably damaging 1.00
IGL02805:Dscaml1 APN 9 45,359,195 (GRCm39) missense probably damaging 0.98
IGL03409:Dscaml1 APN 9 45,581,401 (GRCm39) missense probably damaging 1.00
D3080:Dscaml1 UTSW 9 45,595,623 (GRCm39) missense probably benign 0.44
IGL03050:Dscaml1 UTSW 9 45,654,297 (GRCm39) missense probably damaging 1.00
R0149:Dscaml1 UTSW 9 45,653,978 (GRCm39) nonsense probably null
R0582:Dscaml1 UTSW 9 45,579,562 (GRCm39) missense possibly damaging 0.77
R0629:Dscaml1 UTSW 9 45,632,716 (GRCm39) missense probably damaging 0.98
R0632:Dscaml1 UTSW 9 45,643,432 (GRCm39) missense probably benign 0.06
R0815:Dscaml1 UTSW 9 45,656,372 (GRCm39) missense probably benign 0.00
R1162:Dscaml1 UTSW 9 45,663,647 (GRCm39) splice site probably benign
R1449:Dscaml1 UTSW 9 45,653,521 (GRCm39) missense possibly damaging 0.95
R1474:Dscaml1 UTSW 9 45,596,519 (GRCm39) missense probably damaging 1.00
R1481:Dscaml1 UTSW 9 45,583,941 (GRCm39) missense probably benign 0.01
R1533:Dscaml1 UTSW 9 45,361,882 (GRCm39) missense probably damaging 0.99
R1542:Dscaml1 UTSW 9 45,660,738 (GRCm39) missense possibly damaging 0.84
R1572:Dscaml1 UTSW 9 45,632,631 (GRCm39) missense probably benign 0.00
R1627:Dscaml1 UTSW 9 45,664,445 (GRCm39) missense probably damaging 1.00
R1634:Dscaml1 UTSW 9 45,584,047 (GRCm39) missense probably damaging 1.00
R1713:Dscaml1 UTSW 9 45,663,988 (GRCm39) missense possibly damaging 0.49
R1777:Dscaml1 UTSW 9 45,595,054 (GRCm39) missense possibly damaging 0.58
R1812:Dscaml1 UTSW 9 45,662,584 (GRCm39) critical splice donor site probably null
R1834:Dscaml1 UTSW 9 45,594,930 (GRCm39) missense probably benign 0.00
R1907:Dscaml1 UTSW 9 45,651,778 (GRCm39) missense probably damaging 1.00
R1953:Dscaml1 UTSW 9 45,581,522 (GRCm39) missense probably benign 0.01
R2056:Dscaml1 UTSW 9 45,661,430 (GRCm39) missense probably damaging 0.99
R2193:Dscaml1 UTSW 9 45,596,532 (GRCm39) missense probably benign 0.21
R2497:Dscaml1 UTSW 9 45,656,376 (GRCm39) missense probably benign 0.00
R3768:Dscaml1 UTSW 9 45,643,435 (GRCm39) missense possibly damaging 0.94
R3891:Dscaml1 UTSW 9 45,628,782 (GRCm39) missense possibly damaging 0.84
R4110:Dscaml1 UTSW 9 45,643,366 (GRCm39) missense probably benign 0.07
R4706:Dscaml1 UTSW 9 45,361,878 (GRCm39) missense probably damaging 1.00
R4716:Dscaml1 UTSW 9 45,361,890 (GRCm39) missense probably damaging 1.00
R4719:Dscaml1 UTSW 9 45,583,993 (GRCm39) missense probably benign 0.13
R4770:Dscaml1 UTSW 9 45,581,404 (GRCm39) missense probably damaging 1.00
R4924:Dscaml1 UTSW 9 45,656,487 (GRCm39) missense probably damaging 1.00
R5167:Dscaml1 UTSW 9 45,628,730 (GRCm39) missense probably damaging 1.00
R5346:Dscaml1 UTSW 9 45,361,857 (GRCm39) missense possibly damaging 0.63
R5737:Dscaml1 UTSW 9 45,656,483 (GRCm39) missense probably damaging 0.99
R5977:Dscaml1 UTSW 9 45,632,596 (GRCm39) missense probably benign 0.19
R6073:Dscaml1 UTSW 9 45,361,881 (GRCm39) missense probably benign 0.22
R6276:Dscaml1 UTSW 9 45,579,458 (GRCm39) missense possibly damaging 0.62
R6415:Dscaml1 UTSW 9 45,594,975 (GRCm39) nonsense probably null
R6527:Dscaml1 UTSW 9 45,623,482 (GRCm39) nonsense probably null
R6582:Dscaml1 UTSW 9 45,664,104 (GRCm39) missense probably benign 0.00
R6655:Dscaml1 UTSW 9 45,658,235 (GRCm39) missense probably benign 0.00
R6772:Dscaml1 UTSW 9 45,621,609 (GRCm39) missense probably damaging 1.00
R6799:Dscaml1 UTSW 9 45,361,881 (GRCm39) missense probably benign 0.22
R6892:Dscaml1 UTSW 9 45,595,128 (GRCm39) missense probably damaging 0.99
R6918:Dscaml1 UTSW 9 45,341,805 (GRCm39) missense probably benign
R6967:Dscaml1 UTSW 9 45,585,821 (GRCm39) missense probably damaging 0.97
R7214:Dscaml1 UTSW 9 45,581,437 (GRCm39) missense probably benign 0.01
R7286:Dscaml1 UTSW 9 45,654,044 (GRCm39) critical splice donor site probably null
R7315:Dscaml1 UTSW 9 45,656,423 (GRCm39) missense probably benign 0.00
R7338:Dscaml1 UTSW 9 45,585,802 (GRCm39) missense probably benign 0.12
R7343:Dscaml1 UTSW 9 45,664,214 (GRCm39) missense probably benign
R7439:Dscaml1 UTSW 9 45,621,624 (GRCm39) missense possibly damaging 0.94
R7484:Dscaml1 UTSW 9 45,660,744 (GRCm39) splice site probably null
R7545:Dscaml1 UTSW 9 45,596,681 (GRCm39) missense probably benign 0.11
R7979:Dscaml1 UTSW 9 45,595,029 (GRCm39) missense probably damaging 1.00
R8005:Dscaml1 UTSW 9 45,628,808 (GRCm39) missense probably damaging 1.00
R8181:Dscaml1 UTSW 9 45,658,140 (GRCm39) missense possibly damaging 0.86
R8262:Dscaml1 UTSW 9 45,658,438 (GRCm39) intron probably benign
R8428:Dscaml1 UTSW 9 45,653,884 (GRCm39) missense probably benign 0.00
R8725:Dscaml1 UTSW 9 45,341,759 (GRCm39) missense probably benign 0.00
R8727:Dscaml1 UTSW 9 45,341,759 (GRCm39) missense probably benign 0.00
R8796:Dscaml1 UTSW 9 45,359,026 (GRCm39) missense probably damaging 0.99
R8840:Dscaml1 UTSW 9 45,634,718 (GRCm39) missense probably damaging 0.99
R9291:Dscaml1 UTSW 9 45,359,251 (GRCm39) missense probably damaging 1.00
R9394:Dscaml1 UTSW 9 45,661,354 (GRCm39) missense possibly damaging 0.64
R9610:Dscaml1 UTSW 9 45,579,522 (GRCm39) missense possibly damaging 0.95
R9611:Dscaml1 UTSW 9 45,579,522 (GRCm39) missense possibly damaging 0.95
R9653:Dscaml1 UTSW 9 45,643,466 (GRCm39) critical splice donor site probably null
R9699:Dscaml1 UTSW 9 45,654,315 (GRCm39) missense probably damaging 0.97
X0058:Dscaml1 UTSW 9 45,663,426 (GRCm39) missense probably benign 0.00
Z1177:Dscaml1 UTSW 9 45,584,089 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGACCCTTTAGAATCTCCCTC -3'
(R):5'- CGGTGATGATGCTGTTTCCATC -3'

Sequencing Primer
(F):5'- TCCCAATCCCCCTAGAATGTC -3'
(R):5'- AAATCTCTGAGTCCAGCGCAGG -3'
Posted On 2019-09-13