Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Armc8'

573752

Institutional Source

Beutler Lab

Gene Symbol

Armc8

Ensembl Gene

ENSMUSG00000032468

Gene Name

armadillo repeat containing 8

Synonyms

1200015K23Rik, HSPC056, Gid5

MMRRC Submission

Accession Numbers

Genbank: NM_028768; MGI: 1921375

Essential gene?

Possibly essential (E-score: 0.678) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

99478372-99568899 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99533132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 165 (E165G)

Ref Sequence

ENSEMBL: ENSMUSP00000035043 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035043] [ENSMUST00000185524] [ENSMUST00000186049]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035043
AA Change: E165G

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000035043
Gene: ENSMUSG00000032468
AA Change: E165G

Domain	Start	End	E-Value	Type
ARM	50	92	1.75e0	SMART
ARM	94	134	5.34e0	SMART
ARM	177	217	2.04e1	SMART
ARM	372	413	3.58e1	SMART
Blast:ARM	414	455	7e-17	BLAST
ARM	457	497	3.81e-1	SMART
ARM	500	540	5.43e1	SMART
Blast:ARM	542	585	1e-20	BLAST
Blast:ARM	633	673	1e-16	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000185524
AA Change: E165G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139973
Gene: ENSMUSG00000032468
AA Change: E165G

Domain	Start	End	E-Value	Type
ARM	50	92	1.75e0	SMART
ARM	94	134	5.34e0	SMART
Blast:ARM	138	176	1e-5	BLAST
ARM	177	217	2.04e1	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000186049
AA Change: E123G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000140426
Gene: ENSMUSG00000032468
AA Change: E123G

Domain	Start	End	E-Value	Type
ARM	8	50	8.5e-3	SMART
ARM	52	92	2.6e-2	SMART
Blast:ARM	96	134	7e-6	BLAST
ARM	135	175	9.8e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

Allele List at MGI

All alleles(6) : Targeted, other(2) Gene trapped(4)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Armc8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Armc8	APN	9	99505734	critical splice acceptor site	probably null
IGL00951:Armc8	APN	9	99505704	missense	probably benign	0.00
IGL01776:Armc8	APN	9	99526883	splice site	probably benign
IGL02215:Armc8	APN	9	99483978	missense	possibly damaging	0.92
IGL02244:Armc8	APN	9	99483174	missense	probably benign	0.10
IGL02610:Armc8	APN	9	99527069	splice site	probably benign
IGL02612:Armc8	APN	9	99527069	splice site	probably benign
IGL02615:Armc8	APN	9	99527069	splice site	probably benign
IGL02619:Armc8	APN	9	99527069	splice site	probably benign
IGL02621:Armc8	APN	9	99527069	splice site	probably benign
IGL02622:Armc8	APN	9	99527069	splice site	probably benign
IGL02623:Armc8	APN	9	99527069	splice site	probably benign
IGL02624:Armc8	APN	9	99527069	splice site	probably benign
Scrambler	UTSW	9	99496149	critical splice donor site	probably null
warthog	UTSW	9	99520485	missense	probably benign	0.02
D4043:Armc8	UTSW	9	99483976	missense	probably benign	0.13
R0321:Armc8	UTSW	9	99533177	missense	probably damaging	0.99
R0498:Armc8	UTSW	9	99497292	missense	probably damaging	1.00
R0646:Armc8	UTSW	9	99505688	missense	probably damaging	1.00
R0658:Armc8	UTSW	9	99536158	splice site	probably benign
R1061:Armc8	UTSW	9	99537731	missense	probably damaging	1.00
R1406:Armc8	UTSW	9	99523248	missense	probably benign	0.37
R1406:Armc8	UTSW	9	99523248	missense	probably benign	0.37
R1429:Armc8	UTSW	9	99536207	missense	possibly damaging	0.67
R1432:Armc8	UTSW	9	99523132	splice site	probably benign
R1538:Armc8	UTSW	9	99505290	missense	probably damaging	0.96
R1606:Armc8	UTSW	9	99537729	missense	probably damaging	0.98
R1817:Armc8	UTSW	9	99536259	missense	possibly damaging	0.67
R1866:Armc8	UTSW	9	99536280	missense	probably benign
R2015:Armc8	UTSW	9	99483105	nonsense	probably null
R2143:Armc8	UTSW	9	99505308	missense	probably damaging	0.99
R2251:Armc8	UTSW	9	99502600	critical splice acceptor site	probably null
R2842:Armc8	UTSW	9	99505681	missense	probably benign
R3010:Armc8	UTSW	9	99487913	missense	probably benign	0.06
R3709:Armc8	UTSW	9	99520497	missense	probably damaging	1.00
R4440:Armc8	UTSW	9	99484034	missense	probably benign	0.37
R4865:Armc8	UTSW	9	99526889	critical splice donor site	probably null
R5492:Armc8	UTSW	9	99527131	nonsense	probably null
R5606:Armc8	UTSW	9	99536262	missense	probably benign	0.23
R5639:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5693:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5694:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5698:Armc8	UTSW	9	99535820	missense	probably benign	0.12
R5700:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5701:Armc8	UTSW	9	99496149	critical splice donor site	probably null
R5735:Armc8	UTSW	9	99497394	critical splice acceptor site	probably null
R6314:Armc8	UTSW	9	99535884	missense	probably benign	0.28
R7034:Armc8	UTSW	9	99483965	critical splice donor site	probably null
R7036:Armc8	UTSW	9	99483965	critical splice donor site	probably null
R7393:Armc8	UTSW	9	99483999	missense	possibly damaging	0.47
R7937:Armc8	UTSW	9	99536219	missense	probably damaging	0.98
R8130:Armc8	UTSW	9	99551547	missense	probably benign	0.02
R8373:Armc8	UTSW	9	99527099	missense	probably benign	0.02
R8734:Armc8	UTSW	9	99520485	missense	probably benign	0.02
R9098:Armc8	UTSW	9	99505309	nonsense	probably null
R9255:Armc8	UTSW	9	99497388	missense	possibly damaging	0.95
R9358:Armc8	UTSW	9	99568600	critical splice donor site	probably null
R9463:Armc8	UTSW	9	99496150	critical splice donor site	probably null
Z1177:Armc8	UTSW	9	99497386	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCTGAAGAGTACACAGAGCTC -3'
(R):5'- CCTTGAAGAGACTTGATTTAGTGCC -3'

Sequencing Primer
(F):5'- CTCAGAGATGTCGCCTAAGCAG -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'

Posted On

2019-09-13