Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Stag1'

573753

Institutional Source

Beutler Lab

Gene Symbol

Stag1

Ensembl Gene

ENSMUSG00000037286

Gene Name

stromal antigen 1

Synonyms

Scc3, SA-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7395 (G1)

Quality Score

216.009

Status

Validated

Chromosome

Chromosomal Location

100597798-100959375 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 100796728 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 234 (V234G)

Ref Sequence

ENSEMBL: ENSMUSP00000116205 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041418] [ENSMUST00000123302] [ENSMUST00000129269] [ENSMUST00000138405] [ENSMUST00000146312] [ENSMUST00000155108]

AlphaFold

Q9D3E6

Predicted Effect

probably damaging
Transcript: ENSMUST00000041418
AA Change: V234G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040724
Gene: ENSMUSG00000037286
AA Change: V234G

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:STAG	157	276	1.5e-50	PFAM
SCOP:d1qbkb_	279	850	4e-5	SMART
low complexity region	1062	1081	N/A	INTRINSIC
low complexity region	1107	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000123302
AA Change: V234G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117879
Gene: ENSMUSG00000037286
AA Change: V234G

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:STAG	157	276	2.9e-51	PFAM
low complexity region	303	315	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000129269
AA Change: V234G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000116205
Gene: ENSMUSG00000037286
AA Change: V234G

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:STAG	160	274	3.8e-41	PFAM
SCOP:d1qbkb_	279	850	3e-5	SMART
low complexity region	1062	1081	N/A	INTRINSIC
low complexity region	1107	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000138405
AA Change: V234G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116322
Gene: ENSMUSG00000037286
AA Change: V234G

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:STAG	157	276	1.5e-51	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000146312
AA Change: V176G

SMART Domains

Protein: ENSMUSP00000116597
Gene: ENSMUSG00000037286
AA Change: V176G

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC
Pfam:STAG	99	196	4.2e-46	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000155108

SMART Domains

Protein: ENSMUSP00000118952
Gene: ENSMUSG00000037286

Domain	Start	End	E-Value	Type
low complexity region	32	44	N/A	INTRINSIC
low complexity region	59	72	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the SCC3 family and is expressed in the nucleus. It encodes a component of cohesin, a multisubunit protein complex that provides sister chromatid cohesion along the length of a chromosome from DNA replication through prophase and prometaphase, after which it is dissociated in preparation for segregation during anaphase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mouse embryos homozygous for a null mutation show developmental delay and die before birth. Heterozygous animals have shorter lifespan and earlier onset of tumourigenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Stag1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00649:Stag1	APN	9	100776808	missense	probably damaging	1.00
IGL01010:Stag1	APN	9	100945933	missense	probably benign	0.06
IGL01012:Stag1	APN	9	100855859	missense	possibly damaging	0.47
IGL01025:Stag1	APN	9	100951657	missense	possibly damaging	0.95
IGL01307:Stag1	APN	9	100951788	intron	probably benign
IGL02149:Stag1	APN	9	100887389	missense	probably benign	0.09
IGL02608:Stag1	APN	9	100757769	missense	probably null	0.99
IGL03008:Stag1	APN	9	100776791	missense	probably damaging	1.00
IGL03210:Stag1	APN	9	100845076	missense	possibly damaging	0.63
eto_o	UTSW	9	100796716	missense	probably damaging	1.00
PIT4280001:Stag1	UTSW	9	100942716	missense	possibly damaging	0.95
R0070:Stag1	UTSW	9	100956408	missense	probably null	1.00
R0070:Stag1	UTSW	9	100956408	missense	probably null	1.00
R0349:Stag1	UTSW	9	100776784	missense	probably damaging	0.98
R0479:Stag1	UTSW	9	100928091	missense	probably benign	0.00
R0531:Stag1	UTSW	9	100954247	makesense	probably null
R0962:Stag1	UTSW	9	100796827	missense	probably damaging	1.00
R0976:Stag1	UTSW	9	100776824	missense	probably damaging	0.98
R0976:Stag1	UTSW	9	100930016	critical splice donor site	probably null
R1170:Stag1	UTSW	9	100888453	intron	probably benign
R1499:Stag1	UTSW	9	100855832	missense	possibly damaging	0.77
R1499:Stag1	UTSW	9	100887373	intron	probably benign
R1644:Stag1	UTSW	9	100880900	intron	probably benign
R1747:Stag1	UTSW	9	100888300	missense	probably benign
R1799:Stag1	UTSW	9	100953462	splice site	probably null
R1807:Stag1	UTSW	9	100908666	missense	probably benign	0.34
R1978:Stag1	UTSW	9	100888086	missense	probably benign	0.03
R2029:Stag1	UTSW	9	100786687	missense	probably damaging	1.00
R2161:Stag1	UTSW	9	100889595	missense	probably damaging	1.00
R2300:Stag1	UTSW	9	100712500	missense	possibly damaging	0.92
R2327:Stag1	UTSW	9	100786613	missense	possibly damaging	0.81
R2426:Stag1	UTSW	9	100845116	critical splice donor site	probably null
R2448:Stag1	UTSW	9	100888409	missense	probably benign	0.42
R2504:Stag1	UTSW	9	100866210	missense	probably damaging	0.99
R3713:Stag1	UTSW	9	100889618	missense	probably benign	0.01
R3835:Stag1	UTSW	9	100737982	missense	probably damaging	0.97
R3862:Stag1	UTSW	9	100944785	missense	probably benign	0.02
R4398:Stag1	UTSW	9	100956606	utr 3 prime	probably benign
R4568:Stag1	UTSW	9	100848669	missense	probably damaging	1.00
R4651:Stag1	UTSW	9	100796716	missense	probably damaging	1.00
R4652:Stag1	UTSW	9	100796716	missense	probably damaging	1.00
R4653:Stag1	UTSW	9	100796716	missense	probably damaging	1.00
R4675:Stag1	UTSW	9	100848705	missense	probably damaging	1.00
R4709:Stag1	UTSW	9	100738039	missense	probably damaging	0.99
R4924:Stag1	UTSW	9	100796755	missense	possibly damaging	0.67
R5018:Stag1	UTSW	9	100951619	missense	probably benign	0.00
R5435:Stag1	UTSW	9	100953550	missense	probably benign	0.03
R5460:Stag1	UTSW	9	100956453	splice site	probably null
R5805:Stag1	UTSW	9	100796778	missense	probably damaging	1.00
R6127:Stag1	UTSW	9	100951697	missense	probably benign	0.05
R6313:Stag1	UTSW	9	100757733	missense	probably damaging	1.00
R6597:Stag1	UTSW	9	100887420	missense	probably benign	0.01
R6807:Stag1	UTSW	9	100944850	missense	probably damaging	1.00
R7099:Stag1	UTSW	9	100944826	missense	probably benign	0.02
R7167:Stag1	UTSW	9	100945889	missense	probably benign	0.05
R7504:Stag1	UTSW	9	100888328	missense	probably benign	0.09
R7663:Stag1	UTSW	9	100738138	missense	probably damaging	0.98
R7769:Stag1	UTSW	9	100944827	missense	possibly damaging	0.86
R8245:Stag1	UTSW	9	100929893	missense	probably benign	0.01
R8343:Stag1	UTSW	9	100757766	missense	possibly damaging	0.95
R8473:Stag1	UTSW	9	100880787	missense	probably damaging	1.00
R8709:Stag1	UTSW	9	100890922	intron	probably benign
R8925:Stag1	UTSW	9	100705245	missense	possibly damaging	0.46
R8927:Stag1	UTSW	9	100705245	missense	possibly damaging	0.46
R8951:Stag1	UTSW	9	100880801	missense	probably damaging	1.00
R9138:Stag1	UTSW	9	100947282	missense	probably benign	0.01
R9233:Stag1	UTSW	9	100929971	missense	probably benign	0.00
R9246:Stag1	UTSW	9	100888276	missense	probably benign	0.00
R9419:Stag1	UTSW	9	100929914	missense	probably benign
R9442:Stag1	UTSW	9	100954253	missense	probably damaging	1.00
R9694:Stag1	UTSW	9	100928098	missense	probably benign	0.05
R9740:Stag1	UTSW	9	100705235	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTGAGATTAGTCTATTCCTGTCAG -3'
(R):5'- GACCCGTATGAATTTTCTATTGTCC -3'

Sequencing Primer
(F):5'- AGATTAGTCTATTCCTGTCAGTTACC -3'
(R):5'- AACTTTCTGTGCAGCCAAGG -3'

Posted On

2019-09-13