Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Ap3d1'

573755

Institutional Source

Beutler Lab

Gene Symbol

Ap3d1

Ensembl Gene

ENSMUSG00000020198

Gene Name

adaptor-related protein complex 3, delta 1 subunit

Synonyms

mBLVR1, Bolvr

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.948) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80706956-80742264 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80730882 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 89 (T89A)

Ref Sequence

ENSEMBL: ENSMUSP00000020420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020420]

AlphaFold

O54774

Predicted Effect

probably benign
Transcript: ENSMUST00000020420
AA Change: T89A

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000020420
Gene: ENSMUSG00000020198
AA Change: T89A

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	32	583	6.6e-153	PFAM
Pfam:Cnd1	130	292	2.1e-8	PFAM
low complexity region	629	642	N/A	INTRINSIC
BLVR	660	803	5.3e-80	SMART
low complexity region	835	861	N/A	INTRINSIC
low complexity region	871	881	N/A	INTRINSIC
coiled coil region	910	933	N/A	INTRINSIC
low complexity region	947	964	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the AP3 adaptor-like complex, which is not clathrin-associated, but is associated with the golgi region, as well as more peripheral structures. The AP-3 complex facilitates the budding of vesicles from the golgi membrane, and may be directly involved in trafficking to lysosomes. This subunit is implicated in intracellular biogenesis and trafficking of pigment granules, and possibly platelet dense granules and neurotransmitter vesicles. Defects in this gene are a cause of a new type of Hermansky-Pudlak syndrome. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mutant mice show coat and eye color dilution, platelet defects, lysosomal abnormalities, inner ear degeneration and neurological defects and model Hermansky-Pudlak storage pool deficiency syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Ap3d1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Ap3d1	APN	10	80741979	missense	probably benign	0.00
IGL00827:Ap3d1	APN	10	80713559	missense	possibly damaging	0.92
IGL01668:Ap3d1	APN	10	80719159	missense	possibly damaging	0.95
IGL01934:Ap3d1	APN	10	80709258	nonsense	probably null
IGL03404:Ap3d1	APN	10	80730037	missense	probably damaging	1.00
christian	UTSW	10	80730042	missense	probably damaging	1.00
Particle	UTSW	10	80710494	splice site	probably null
vesicle	UTSW	10	80723827	missense	probably damaging	1.00
R0119:Ap3d1	UTSW	10	80723615	splice site	probably benign
R0197:Ap3d1	UTSW	10	80730042	missense	probably damaging	1.00
R0356:Ap3d1	UTSW	10	80727978	missense	probably damaging	1.00
R0372:Ap3d1	UTSW	10	80723567	missense	probably damaging	1.00
R0491:Ap3d1	UTSW	10	80719241	missense	probably damaging	1.00
R0636:Ap3d1	UTSW	10	80719382	nonsense	probably null
R0792:Ap3d1	UTSW	10	80708479	missense	probably benign
R0942:Ap3d1	UTSW	10	80732955	splice site	probably benign
R1015:Ap3d1	UTSW	10	80716489	missense	probably damaging	1.00
R1023:Ap3d1	UTSW	10	80714258	missense	probably damaging	1.00
R1170:Ap3d1	UTSW	10	80732840	splice site	probably benign
R1540:Ap3d1	UTSW	10	80715941	missense	probably benign	0.00
R1639:Ap3d1	UTSW	10	80730010	missense	probably damaging	0.98
R1664:Ap3d1	UTSW	10	80717737	nonsense	probably null
R1669:Ap3d1	UTSW	10	80710836	unclassified	probably benign
R1839:Ap3d1	UTSW	10	80727108	missense	probably damaging	1.00
R1940:Ap3d1	UTSW	10	80709773	missense	probably benign	0.03
R2081:Ap3d1	UTSW	10	80732936	missense	probably damaging	1.00
R2258:Ap3d1	UTSW	10	80721132	missense	probably benign	0.03
R2281:Ap3d1	UTSW	10	80713998	missense	probably damaging	0.96
R2398:Ap3d1	UTSW	10	80719172	nonsense	probably null
R2849:Ap3d1	UTSW	10	80741908	missense	possibly damaging	0.65
R3856:Ap3d1	UTSW	10	80712185	missense	probably benign
R4350:Ap3d1	UTSW	10	80719285	missense	probably benign	0.15
R4590:Ap3d1	UTSW	10	80719812	nonsense	probably null
R4782:Ap3d1	UTSW	10	80721586	splice site	probably null
R4785:Ap3d1	UTSW	10	80712778	frame shift	probably null
R4834:Ap3d1	UTSW	10	80719726	missense	probably damaging	1.00
R4864:Ap3d1	UTSW	10	80712778	frame shift	probably null
R5051:Ap3d1	UTSW	10	80719199	missense	probably damaging	1.00
R5109:Ap3d1	UTSW	10	80709450	missense	probably benign	0.11
R5219:Ap3d1	UTSW	10	80709817	missense	probably benign	0.03
R5220:Ap3d1	UTSW	10	80727167	missense	probably damaging	1.00
R5307:Ap3d1	UTSW	10	80723549	missense	probably benign	0.29
R5586:Ap3d1	UTSW	10	80719130	missense	possibly damaging	0.92
R5796:Ap3d1	UTSW	10	80714037	missense	possibly damaging	0.70
R5905:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6025:Ap3d1	UTSW	10	80710464	missense	probably benign	0.01
R6028:Ap3d1	UTSW	10	80722927	missense	possibly damaging	0.50
R6364:Ap3d1	UTSW	10	80710494	splice site	probably null
R6469:Ap3d1	UTSW	10	80712158	missense	probably benign
R6603:Ap3d1	UTSW	10	80714047	missense	probably benign	0.04
R6872:Ap3d1	UTSW	10	80714322	nonsense	probably null
R6887:Ap3d1	UTSW	10	80723698	missense	probably damaging	1.00
R7249:Ap3d1	UTSW	10	80741933	missense	probably damaging	1.00
R7316:Ap3d1	UTSW	10	80717859	missense	probably damaging	1.00
R7325:Ap3d1	UTSW	10	80723803	missense	probably damaging	1.00
R7405:Ap3d1	UTSW	10	80741900	missense	probably benign	0.16
R7425:Ap3d1	UTSW	10	80721592	missense	probably damaging	1.00
R7558:Ap3d1	UTSW	10	80722921	missense	possibly damaging	0.92
R7583:Ap3d1	UTSW	10	80709458	missense	probably benign	0.13
R7703:Ap3d1	UTSW	10	80717844	missense	probably damaging	1.00
R7964:Ap3d1	UTSW	10	80730057	missense	probably damaging	1.00
R8021:Ap3d1	UTSW	10	80714301	missense	probably benign	0.30
R8200:Ap3d1	UTSW	10	80722932	nonsense	probably null
R8314:Ap3d1	UTSW	10	80723539	missense	possibly damaging	0.91
R8356:Ap3d1	UTSW	10	80732903	missense	probably damaging	1.00
R8896:Ap3d1	UTSW	10	80716591	missense	probably benign	0.01
R8936:Ap3d1	UTSW	10	80712118	missense	probably benign	0.02
R9183:Ap3d1	UTSW	10	80709793	missense	probably null	0.06
R9209:Ap3d1	UTSW	10	80719084	missense	probably benign	0.04
R9259:Ap3d1	UTSW	10	80723827	missense	probably damaging	1.00
R9476:Ap3d1	UTSW	10	80709821	missense	probably benign	0.00
R9645:Ap3d1	UTSW	10	80709228	missense	probably benign
R9664:Ap3d1	UTSW	10	80712805	missense	possibly damaging	0.71
R9781:Ap3d1	UTSW	10	80709775	missense	possibly damaging	0.51
X0019:Ap3d1	UTSW	10	80719102	missense	probably damaging	1.00
X0026:Ap3d1	UTSW	10	80721147	missense	possibly damaging	0.46
Z1088:Ap3d1	UTSW	10	80719237	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GACTGAAAACAAAGGCTGCC -3'
(R):5'- AAAGTCCCCAAGGGTTTGTG -3'

Sequencing Primer
(F):5'- ACCACTGTTAAGCCATGTGG -3'
(R):5'- CTGTGTCCAGACTGAGTGTATC -3'

Posted On

2019-09-13