Incidental Mutation 'R0648:Scaf11'
ID 57376
Institutional Source Beutler Lab
Gene Symbol Scaf11
Ensembl Gene ENSMUSG00000033228
Gene Name SR-related CTD-associated factor 11
Synonyms 2610510E10Rik, Srsf2ip, SIP1, Sfrs2ip, SRRP129, CASP11, 1110061H03Rik
MMRRC Submission 038833-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0648 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 96309580-96358695 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 96316339 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1075 (N1075S)
Ref Sequence ENSEMBL: ENSMUSP00000154321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047835] [ENSMUST00000227069] [ENSMUST00000228535]
AlphaFold E9PZM7
Predicted Effect probably benign
Transcript: ENSMUST00000047835
AA Change: N1075S

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000044898
Gene: ENSMUSG00000033228
AA Change: N1075S

DomainStartEndE-ValueType
RING 41 81 1.57e-2 SMART
low complexity region 308 327 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 398 412 N/A INTRINSIC
low complexity region 852 860 N/A INTRINSIC
low complexity region 919 978 N/A INTRINSIC
low complexity region 1089 1108 N/A INTRINSIC
low complexity region 1177 1188 N/A INTRINSIC
low complexity region 1283 1311 N/A INTRINSIC
low complexity region 1346 1359 N/A INTRINSIC
Blast:IG_like 1374 1415 5e-9 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000227069
AA Change: N1075S

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect unknown
Transcript: ENSMUST00000228072
AA Change: N78S
Predicted Effect probably benign
Transcript: ENSMUST00000228535
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 A G 16: 20,184,632 (GRCm39) V1009A possibly damaging Het
Acta2 T C 19: 34,225,934 (GRCm39) I87V probably benign Het
Arid1a A G 4: 133,412,515 (GRCm39) Y1560H unknown Het
Bcor C T X: 11,925,290 (GRCm39) R102Q probably damaging Het
Camsap2 A T 1: 136,232,057 (GRCm39) D179E probably damaging Het
Ccdc168 A G 1: 44,095,723 (GRCm39) S1792P possibly damaging Het
Ccdc18 T A 5: 108,283,426 (GRCm39) S46T probably damaging Het
Ccdc18 A C 5: 108,322,853 (GRCm39) Q651P probably damaging Het
Cdc73 T C 1: 143,571,200 (GRCm39) T80A probably benign Het
Cdh20 T A 1: 109,993,337 (GRCm39) probably benign Het
Cenpe G A 3: 134,935,843 (GRCm39) G426D probably damaging Het
Cenpt A G 8: 106,571,592 (GRCm39) V487A probably damaging Het
Clec2m A G 6: 129,307,932 (GRCm39) F46L probably benign Het
Col4a1 G A 8: 11,296,892 (GRCm39) P84S unknown Het
Dennd2d A G 3: 106,407,871 (GRCm39) I450M probably damaging Het
Dhps C A 8: 85,799,911 (GRCm39) probably null Het
Ebf1 A T 11: 44,882,337 (GRCm39) H431L probably damaging Het
Efcab6 A G 15: 83,817,265 (GRCm39) probably benign Het
Egflam T C 15: 7,237,190 (GRCm39) H990R probably damaging Het
Ercc6l2 A G 13: 63,992,459 (GRCm39) T303A probably benign Het
Fam167b T C 4: 129,472,150 (GRCm39) K7E probably benign Het
Fgd3 T C 13: 49,450,049 (GRCm39) I67V probably benign Het
Fhip1a A C 3: 85,637,921 (GRCm39) V126G probably damaging Het
Fn1 A T 1: 71,636,744 (GRCm39) V2045D possibly damaging Het
Gnl1 A G 17: 36,293,490 (GRCm39) N225S probably damaging Het
Gpx6 A T 13: 21,503,047 (GRCm39) N154Y probably benign Het
H2bc21 A G 3: 96,128,851 (GRCm39) S124G probably benign Het
Haus8 C A 8: 71,709,174 (GRCm39) G79V probably damaging Het
Hdgfl1 A T 13: 26,953,836 (GRCm39) L79Q probably damaging Het
Impdh2 T C 9: 108,440,665 (GRCm39) Y83H probably benign Het
Lama2 T C 10: 26,865,372 (GRCm39) T2929A probably benign Het
Lpin2 T C 17: 71,536,307 (GRCm39) S199P probably benign Het
Moap1 T C 12: 102,708,776 (GRCm39) T258A probably benign Het
Mrps35 C A 6: 146,957,443 (GRCm39) S156* probably null Het
Mrtfa A G 15: 80,901,121 (GRCm39) S457P probably damaging Het
Mtbp C T 15: 55,466,597 (GRCm39) P537S probably benign Het
Ncstn C A 1: 171,895,454 (GRCm39) V565F probably benign Het
Nhsl1 A G 10: 18,407,474 (GRCm39) N1536S possibly damaging Het
Nkain4 T C 2: 180,584,905 (GRCm39) Q103R possibly damaging Het
Nsun2 T A 13: 69,775,706 (GRCm39) N383K probably damaging Het
Or13p4 C T 4: 118,547,269 (GRCm39) V127I probably benign Het
Or6c33 A G 10: 129,853,350 (GRCm39) N40S probably damaging Het
Parp1 C T 1: 180,428,005 (GRCm39) probably benign Het
Pkd1 G A 17: 24,813,911 (GRCm39) R4125H probably damaging Het
Plxnd1 T C 6: 115,970,962 (GRCm39) I269V possibly damaging Het
Polr1f C T 12: 33,487,999 (GRCm39) Q305* probably null Het
Ppp1r36dn A G 12: 76,498,070 (GRCm39) noncoding transcript Het
Qrich1 T A 9: 108,422,076 (GRCm39) N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,004,752 (GRCm39) probably benign Het
Rell1 G A 5: 64,082,088 (GRCm39) T271M probably benign Het
Rgl1 A G 1: 152,412,016 (GRCm39) probably null Het
Rph3a C T 5: 121,097,333 (GRCm39) R261H possibly damaging Het
Ryr2 A T 13: 11,739,219 (GRCm39) M2161K possibly damaging Het
Serpina3j A G 12: 104,280,938 (GRCm39) D37G probably benign Het
Siah2 A G 3: 58,583,635 (GRCm39) V217A probably damaging Het
Sik2 T C 9: 50,810,045 (GRCm39) D506G probably benign Het
Skap2 A C 6: 51,856,765 (GRCm39) V279G probably benign Het
Slc8a3 G T 12: 81,361,220 (GRCm39) T533N probably damaging Het
Slc9a7 A T X: 20,028,659 (GRCm39) probably benign Het
Snai3 G T 8: 123,181,733 (GRCm39) F241L probably damaging Het
Speg T C 1: 75,404,622 (GRCm39) S2805P probably benign Het
Spink5 A T 18: 44,132,864 (GRCm39) probably benign Het
Tctn1 C T 5: 122,389,761 (GRCm39) E254K probably benign Het
Tdrd3 C T 14: 87,709,618 (GRCm39) T100M probably damaging Het
Tex47 T C 5: 7,355,215 (GRCm39) V132A probably benign Het
Thbs3 A G 3: 89,123,972 (GRCm39) probably null Het
Tigit T A 16: 43,482,401 (GRCm39) Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 (GRCm39) I148T probably benign Het
Tmem97 A G 11: 78,441,365 (GRCm39) Y39H probably benign Het
Tnks2 T A 19: 36,839,474 (GRCm39) probably null Het
Trp53bp1 A G 2: 121,066,188 (GRCm39) V846A probably benign Het
Tulp2 T G 7: 45,169,210 (GRCm39) I259S probably damaging Het
Ubxn1 G A 19: 8,851,612 (GRCm39) R215H probably damaging Het
Vmn1r17 A G 6: 57,337,460 (GRCm39) F253L probably damaging Het
Vmn2r10 T C 5: 109,143,782 (GRCm39) M723V probably benign Het
Xndc1 T C 7: 101,728,031 (GRCm39) V14A possibly damaging Het
Xpnpep1 A G 19: 52,986,294 (GRCm39) probably benign Het
Yes1 T A 5: 32,812,862 (GRCm39) M322K possibly damaging Het
Zdhhc14 C A 17: 5,543,877 (GRCm39) N52K probably benign Het
Zfp42 A G 8: 43,749,015 (GRCm39) V162A probably benign Het
Other mutations in Scaf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Scaf11 APN 15 96,316,461 (GRCm39) missense possibly damaging 0.94
IGL01386:Scaf11 APN 15 96,318,361 (GRCm39) missense probably damaging 1.00
IGL01449:Scaf11 APN 15 96,317,007 (GRCm39) missense probably benign 0.04
IGL01547:Scaf11 APN 15 96,316,310 (GRCm39) missense probably benign 0.14
IGL01697:Scaf11 APN 15 96,321,504 (GRCm39) splice site probably benign
IGL01780:Scaf11 APN 15 96,318,725 (GRCm39) missense possibly damaging 0.94
IGL02311:Scaf11 APN 15 96,316,637 (GRCm39) missense probably benign 0.01
IGL02740:Scaf11 APN 15 96,316,883 (GRCm39) missense probably benign 0.01
IGL02805:Scaf11 APN 15 96,318,063 (GRCm39) missense possibly damaging 0.69
IGL03383:Scaf11 APN 15 96,318,064 (GRCm39) splice site probably null
R0173:Scaf11 UTSW 15 96,318,075 (GRCm39) missense probably benign 0.00
R0379:Scaf11 UTSW 15 96,329,697 (GRCm39) missense probably damaging 1.00
R0508:Scaf11 UTSW 15 96,318,368 (GRCm39) missense probably damaging 1.00
R0653:Scaf11 UTSW 15 96,316,522 (GRCm39) nonsense probably null
R0727:Scaf11 UTSW 15 96,317,324 (GRCm39) missense probably damaging 1.00
R0829:Scaf11 UTSW 15 96,316,570 (GRCm39) missense probably damaging 1.00
R0839:Scaf11 UTSW 15 96,321,434 (GRCm39) missense probably damaging 1.00
R0843:Scaf11 UTSW 15 96,329,706 (GRCm39) missense probably damaging 1.00
R0882:Scaf11 UTSW 15 96,316,176 (GRCm39) missense possibly damaging 0.75
R1994:Scaf11 UTSW 15 96,316,721 (GRCm39) nonsense probably null
R2092:Scaf11 UTSW 15 96,313,708 (GRCm39) missense probably damaging 0.98
R2125:Scaf11 UTSW 15 96,317,196 (GRCm39) missense possibly damaging 0.69
R2200:Scaf11 UTSW 15 96,318,404 (GRCm39) missense probably damaging 1.00
R3409:Scaf11 UTSW 15 96,312,745 (GRCm39) missense probably damaging 1.00
R3751:Scaf11 UTSW 15 96,316,417 (GRCm39) missense probably damaging 0.99
R4308:Scaf11 UTSW 15 96,344,396 (GRCm39) missense probably benign 0.00
R4424:Scaf11 UTSW 15 96,316,309 (GRCm39) missense possibly damaging 0.78
R4519:Scaf11 UTSW 15 96,322,719 (GRCm39) missense probably damaging 1.00
R4646:Scaf11 UTSW 15 96,317,981 (GRCm39) splice site probably null
R4647:Scaf11 UTSW 15 96,317,981 (GRCm39) splice site probably null
R4724:Scaf11 UTSW 15 96,312,729 (GRCm39) missense probably benign 0.40
R4748:Scaf11 UTSW 15 96,318,302 (GRCm39) nonsense probably null
R4926:Scaf11 UTSW 15 96,316,123 (GRCm39) missense possibly damaging 0.87
R4978:Scaf11 UTSW 15 96,313,798 (GRCm39) missense probably damaging 1.00
R5105:Scaf11 UTSW 15 96,318,313 (GRCm39) missense probably damaging 1.00
R5120:Scaf11 UTSW 15 96,317,423 (GRCm39) missense probably benign 0.26
R5277:Scaf11 UTSW 15 96,317,107 (GRCm39) missense probably damaging 1.00
R5377:Scaf11 UTSW 15 96,315,001 (GRCm39) missense possibly damaging 0.55
R5394:Scaf11 UTSW 15 96,317,339 (GRCm39) missense probably benign 0.28
R5481:Scaf11 UTSW 15 96,318,498 (GRCm39) missense probably damaging 1.00
R5831:Scaf11 UTSW 15 96,314,962 (GRCm39) missense probably benign 0.14
R5941:Scaf11 UTSW 15 96,318,189 (GRCm39) missense probably damaging 0.99
R6123:Scaf11 UTSW 15 96,318,335 (GRCm39) missense probably benign 0.29
R6166:Scaf11 UTSW 15 96,322,543 (GRCm39) missense probably damaging 1.00
R6504:Scaf11 UTSW 15 96,317,341 (GRCm39) splice site probably null
R6863:Scaf11 UTSW 15 96,317,300 (GRCm39) missense probably damaging 1.00
R7135:Scaf11 UTSW 15 96,318,209 (GRCm39) missense possibly damaging 0.82
R7193:Scaf11 UTSW 15 96,317,042 (GRCm39) missense probably damaging 1.00
R7384:Scaf11 UTSW 15 96,318,268 (GRCm39) missense possibly damaging 0.92
R7790:Scaf11 UTSW 15 96,316,942 (GRCm39) missense possibly damaging 0.60
R8056:Scaf11 UTSW 15 96,312,698 (GRCm39) nonsense probably null
R8104:Scaf11 UTSW 15 96,316,483 (GRCm39) missense probably benign 0.34
R8129:Scaf11 UTSW 15 96,317,350 (GRCm39) missense probably damaging 1.00
R8134:Scaf11 UTSW 15 96,318,592 (GRCm39) missense probably damaging 1.00
R8523:Scaf11 UTSW 15 96,316,988 (GRCm39) missense probably damaging 1.00
R8743:Scaf11 UTSW 15 96,313,669 (GRCm39) missense probably benign 0.16
R8955:Scaf11 UTSW 15 96,318,371 (GRCm39) missense probably damaging 0.98
R8987:Scaf11 UTSW 15 96,316,557 (GRCm39) nonsense probably null
R9118:Scaf11 UTSW 15 96,319,886 (GRCm39) missense probably benign
R9127:Scaf11 UTSW 15 96,312,764 (GRCm39) missense probably benign 0.01
R9534:Scaf11 UTSW 15 96,318,209 (GRCm39) missense possibly damaging 0.84
R9628:Scaf11 UTSW 15 96,317,398 (GRCm39) missense probably benign 0.15
R9630:Scaf11 UTSW 15 96,316,049 (GRCm39) missense probably damaging 1.00
R9688:Scaf11 UTSW 15 96,313,808 (GRCm39) missense probably damaging 1.00
R9689:Scaf11 UTSW 15 96,316,195 (GRCm39) missense probably damaging 1.00
R9746:Scaf11 UTSW 15 96,318,298 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGAAAGAGTCGCTCCCTGAGAG -3'
(R):5'- ACAAATGATGGTTGGAGGTGTCCC -3'

Sequencing Primer
(F):5'- CTGAGAGGGGTGTACGGC -3'
(R):5'- GTGTCCCAGAGGAAATGACC -3'
Posted On 2013-07-11