Incidental Mutation 'R7395:Zbtb4'
ID 573760
Institutional Source Beutler Lab
Gene Symbol Zbtb4
Ensembl Gene ENSMUSG00000018750
Gene Name zinc finger and BTB domain containing 4
Synonyms 9230111I22Rik, 2310026P19Rik
MMRRC Submission 045477-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7395 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 69656738-69674849 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69666937 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 81 (T81S)
Ref Sequence ENSEMBL: ENSMUSP00000104279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108638] [ENSMUST00000108639] [ENSMUST00000108640] [ENSMUST00000108642] [ENSMUST00000132528] [ENSMUST00000153943] [ENSMUST00000156932]
AlphaFold Q5F293
Predicted Effect probably benign
Transcript: ENSMUST00000108638
AA Change: T81S

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000104278
Gene: ENSMUSG00000018750
AA Change: T81S

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108639
AA Change: T81S

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104279
Gene: ENSMUSG00000018750
AA Change: T81S

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108640
AA Change: T81S

PolyPhen 2 Score 0.579 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104280
Gene: ENSMUSG00000018750
AA Change: T81S

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108642
AA Change: T81S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104282
Gene: ENSMUSG00000018750
AA Change: T81S

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132528
SMART Domains Protein: ENSMUSP00000121694
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 56 6.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153943
SMART Domains Protein: ENSMUSP00000118027
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 51 5.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156932
SMART Domains Protein: ENSMUSP00000115687
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 51 6e-8 PFAM
low complexity region 68 85 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Meta Mutation Damage Score 0.0635 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 55,184,140 (GRCm39) probably null Het
4930433I11Rik A T 7: 40,639,102 (GRCm39) T13S probably damaging Het
Abca13 A G 11: 9,241,658 (GRCm39) I1174V probably benign Het
Acoxl G A 2: 127,726,336 (GRCm39) V237M probably damaging Het
Adam33 A C 2: 130,903,089 (GRCm39) W52G probably benign Het
Adgrv1 T C 13: 81,707,467 (GRCm39) H1313R probably damaging Het
Ap3d1 T C 10: 80,566,716 (GRCm39) T89A probably benign Het
Armc8 T C 9: 99,415,185 (GRCm39) E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,949 (GRCm39) *383Q probably null Het
Atp8b4 A T 2: 126,217,614 (GRCm39) L634Q possibly damaging Het
B3glct A G 5: 149,649,069 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Bicd2 A G 13: 49,531,706 (GRCm39) D316G possibly damaging Het
Bop1 A T 15: 76,338,041 (GRCm39) S610T probably damaging Het
Car11 T A 7: 45,350,745 (GRCm39) Y80* probably null Het
Ccdc121rt2 A T 5: 112,598,035 (GRCm39) E194V possibly damaging Het
Ccdc96 T C 5: 36,642,609 (GRCm39) I205T probably benign Het
Ces2a A G 8: 105,466,273 (GRCm39) E390G probably benign Het
Cfap54 C A 10: 92,720,565 (GRCm39) V2630L unknown Het
Chek2 G T 5: 111,019,974 (GRCm39) probably null Het
Cntn3 C T 6: 102,314,355 (GRCm39) probably null Het
Cpne3 A T 4: 19,528,239 (GRCm39) D339E probably damaging Het
Crocc2 C T 1: 93,143,829 (GRCm39) Q1403* probably null Het
Crppa A T 12: 36,551,994 (GRCm39) I283F possibly damaging Het
Csnka2ip G A 16: 64,299,803 (GRCm39) T187I Het
Ctu1 A G 7: 43,326,019 (GRCm39) H226R possibly damaging Het
Cubn G T 2: 13,291,875 (GRCm39) Q3317K probably damaging Het
Cyp17a1 A G 19: 46,659,134 (GRCm39) L169P probably benign Het
Dcc T A 18: 71,507,640 (GRCm39) K911* probably null Het
Dcun1d2 G A 8: 13,328,675 (GRCm39) R75* probably null Het
Defb19 A T 2: 152,421,943 (GRCm39) probably null Het
Dffb A T 4: 154,053,570 (GRCm39) S257R probably damaging Het
Dip2c A C 13: 9,664,413 (GRCm39) N942T probably damaging Het
Dnah3 T A 7: 119,565,474 (GRCm39) I169F Het
Dnah3 T C 7: 119,660,183 (GRCm39) M830V probably benign Het
Dnajc5g G A 5: 31,269,009 (GRCm39) S130N possibly damaging Het
Dscaml1 C A 9: 45,613,703 (GRCm39) Q939K possibly damaging Het
Evpl G C 11: 116,117,905 (GRCm39) N761K possibly damaging Het
Fbxw8 A T 5: 118,206,280 (GRCm39) I556N probably damaging Het
Fry G T 5: 150,304,348 (GRCm39) M579I possibly damaging Het
Ggt7 A T 2: 155,337,800 (GRCm39) M488K probably benign Het
Gnpnat1 T A 14: 45,619,038 (GRCm39) H107L probably benign Het
Golga2 C A 2: 32,195,599 (GRCm39) P798Q possibly damaging Het
Gpr35 G A 1: 92,910,929 (GRCm39) A214T probably damaging Het
Greb1 A T 12: 16,759,431 (GRCm39) probably null Het
Hdac10 G A 15: 89,012,487 (GRCm39) T32I probably benign Het
Hkdc1 G A 10: 62,221,478 (GRCm39) T860I probably damaging Het
Icam5 C A 9: 20,946,738 (GRCm39) P422Q possibly damaging Het
Ist1 A C 8: 110,404,159 (GRCm39) S238A probably benign Het
Lrig2 T C 3: 104,404,836 (GRCm39) N91D probably benign Het
Mapt A C 11: 104,218,949 (GRCm39) D352A probably damaging Het
Micall2 G A 5: 139,702,124 (GRCm39) P373L possibly damaging Het
Mocs1 A G 17: 49,761,585 (GRCm39) S560G possibly damaging Het
Mpo A G 11: 87,691,950 (GRCm39) D461G probably damaging Het
Myo1a G T 10: 127,546,309 (GRCm39) V271L probably damaging Het
Ncoa1 G A 12: 4,345,188 (GRCm39) P720S not run Het
Ncr1 T A 7: 4,341,150 (GRCm39) I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 (GRCm39) R66C probably damaging Het
Obox5 A T 7: 15,492,668 (GRCm39) S208C probably damaging Het
Or10q1 T C 19: 13,726,502 (GRCm39) S11P probably damaging Het
Or2n1d A T 17: 38,646,755 (GRCm39) K236* probably null Het
Or5p75-ps1 T A 7: 108,107,611 (GRCm39) F116Y unknown Het
Or7d9 T A 9: 20,197,826 (GRCm39) M285K probably damaging Het
Padi4 A C 4: 140,488,983 (GRCm39) V152G probably damaging Het
Pdzd7 A T 19: 45,025,450 (GRCm39) D348E probably damaging Het
Pdzph1 T A 17: 59,186,154 (GRCm39) K1212N possibly damaging Het
Piezo2 C T 18: 63,160,634 (GRCm39) G2341R probably damaging Het
Plb1 A G 5: 32,511,028 (GRCm39) K1298E probably benign Het
Prr14l A G 5: 32,985,982 (GRCm39) L1171P probably benign Het
Rab11fip5 T C 6: 85,318,850 (GRCm39) T680A probably benign Het
Rev1 A T 1: 38,127,146 (GRCm39) N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Ryr2 A G 13: 11,799,997 (GRCm39) C917R probably damaging Het
Sall1 A T 8: 89,757,549 (GRCm39) S852T possibly damaging Het
Serpine2 A G 1: 79,779,272 (GRCm39) F296L probably damaging Het
Slc12a6 A T 2: 112,182,887 (GRCm39) N754I probably damaging Het
Slc39a6 A T 18: 24,718,332 (GRCm39) L575Q probably damaging Het
Smarcc2 T A 10: 128,321,475 (GRCm39) L890Q probably damaging Het
Smg5 T A 3: 88,268,378 (GRCm39) V1006D probably damaging Het
Ssh2 T C 11: 77,283,899 (GRCm39) V51A probably damaging Het
St14 T C 9: 31,008,195 (GRCm39) K547E probably benign Het
Stag1 T G 9: 100,678,781 (GRCm39) V234G probably damaging Het
Stag3 A T 5: 138,280,207 (GRCm39) Q24L probably benign Het
Stra6 T C 9: 58,048,380 (GRCm39) Y158H probably damaging Het
Tcstv1a A T 13: 120,355,666 (GRCm39) probably null Het
Tmem196 G A 12: 119,975,002 (GRCm39) C62Y probably damaging Het
Tmem265 T A 7: 127,164,039 (GRCm39) F84L Het
Tph1 C T 7: 46,306,627 (GRCm39) probably null Het
Ttn A G 2: 76,776,834 (GRCm39) I1522T unknown Het
Ulk4 T A 9: 121,084,178 (GRCm39) Q129L probably benign Het
Usp17la T A 7: 104,510,792 (GRCm39) S466T probably benign Het
Vmn2r31 A T 7: 7,387,744 (GRCm39) V609E probably damaging Het
Vmn2r52 C T 7: 9,904,744 (GRCm39) C365Y probably benign Het
Zfp605 A T 5: 110,259,885 (GRCm39) probably benign Het
Other mutations in Zbtb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Zbtb4 APN 11 69,667,557 (GRCm39) nonsense probably null
IGL02178:Zbtb4 APN 11 69,667,255 (GRCm39) nonsense probably null
R0092:Zbtb4 UTSW 11 69,670,177 (GRCm39) missense probably benign
R0403:Zbtb4 UTSW 11 69,668,465 (GRCm39) missense probably damaging 0.99
R1276:Zbtb4 UTSW 11 69,667,045 (GRCm39) missense probably damaging 1.00
R1654:Zbtb4 UTSW 11 69,669,995 (GRCm39) missense probably damaging 0.98
R1734:Zbtb4 UTSW 11 69,667,289 (GRCm39) missense probably benign 0.13
R1762:Zbtb4 UTSW 11 69,669,743 (GRCm39) missense probably benign 0.03
R2224:Zbtb4 UTSW 11 69,667,184 (GRCm39) missense probably benign 0.43
R2930:Zbtb4 UTSW 11 69,667,342 (GRCm39) nonsense probably null
R4670:Zbtb4 UTSW 11 69,667,355 (GRCm39) missense probably damaging 0.97
R4998:Zbtb4 UTSW 11 69,669,497 (GRCm39) missense probably benign 0.31
R5956:Zbtb4 UTSW 11 69,669,040 (GRCm39) missense probably benign 0.29
R5988:Zbtb4 UTSW 11 69,669,790 (GRCm39) missense probably damaging 1.00
R6115:Zbtb4 UTSW 11 69,667,148 (GRCm39) missense probably damaging 1.00
R6237:Zbtb4 UTSW 11 69,669,069 (GRCm39) missense possibly damaging 0.70
R6803:Zbtb4 UTSW 11 69,669,454 (GRCm39) missense possibly damaging 0.92
R7756:Zbtb4 UTSW 11 69,669,368 (GRCm39) missense probably benign 0.27
R7758:Zbtb4 UTSW 11 69,669,368 (GRCm39) missense probably benign 0.27
R7877:Zbtb4 UTSW 11 69,666,863 (GRCm39) missense probably benign 0.39
R8215:Zbtb4 UTSW 11 69,669,598 (GRCm39) missense probably benign 0.00
R8306:Zbtb4 UTSW 11 69,668,309 (GRCm39) missense probably damaging 1.00
R8407:Zbtb4 UTSW 11 69,669,101 (GRCm39) missense probably benign 0.00
R8690:Zbtb4 UTSW 11 69,667,618 (GRCm39) missense probably damaging 1.00
R8785:Zbtb4 UTSW 11 69,668,989 (GRCm39) missense possibly damaging 0.48
R9032:Zbtb4 UTSW 11 69,672,650 (GRCm39) missense probably benign
R9674:Zbtb4 UTSW 11 69,669,973 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TATGTTTAGGCTGGCATCATGC -3'
(R):5'- AGCTCCAATCTCTGCCACAG -3'

Sequencing Primer
(F):5'- GTCCTGCATCAGCTCAATGAG -3'
(R):5'- AATCTCTGCCACAGCTGCC -3'
Posted On 2019-09-13