Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Ssh2'

573761

Institutional Source

Beutler Lab

Gene Symbol

Ssh2

Ensembl Gene

ENSMUSG00000037926

Gene Name

slingshot protein phosphatase 2

Synonyms

SSH-2

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77216287-77460220 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 77393073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 51 (V51A)

Ref Sequence

ENSEMBL: ENSMUSP00000137933 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000156488] [ENSMUST00000181283]

AlphaFold

Q5SW75

Predicted Effect

probably damaging
Transcript: ENSMUST00000037912
AA Change: V44A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: V44A

Domain	Start	End	E-Value	Type
low complexity region	9	18	N/A	INTRINSIC
Pfam:DEK_C	251	302	3.1e-13	PFAM
DSPc	307	445	2.2e-41	SMART
low complexity region	459	469	N/A	INTRINSIC
low complexity region	871	882	N/A	INTRINSIC
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1370	1385	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000156488
AA Change: V71A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000119681
Gene: ENSMUSG00000037926
AA Change: V71A

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000181283
AA Change: V51A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: V51A

Domain	Start	End	E-Value	Type
Pfam:DEK_C	256	309	1.7e-18	PFAM
DSPc	313	451	2.2e-41	SMART
low complexity region	465	475	N/A	INTRINSIC
low complexity region	877	888	N/A	INTRINSIC
low complexity region	1008	1020	N/A	INTRINSIC
low complexity region	1376	1391	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Ssh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00811:Ssh2	APN	11	77441926	missense	probably damaging	1.00
IGL01141:Ssh2	APN	11	77449726	missense	probably damaging	1.00
IGL01520:Ssh2	APN	11	77449906	missense	probably damaging	1.00
IGL01803:Ssh2	APN	11	77425330	missense	probably damaging	0.99
IGL01989:Ssh2	APN	11	77453685	missense	possibly damaging	0.79
IGL02322:Ssh2	APN	11	77416413	critical splice acceptor site	probably null
IGL02466:Ssh2	APN	11	77416407	splice site	probably benign
IGL02683:Ssh2	APN	11	77398256	missense	probably damaging	0.99
IGL02706:Ssh2	APN	11	77453406	missense	possibly damaging	0.68
IGL02719:Ssh2	APN	11	77425587	missense	probably damaging	1.00
IGL02721:Ssh2	APN	11	77454725	nonsense	probably null
IGL02732:Ssh2	APN	11	77437776	splice site	probably null
IGL02745:Ssh2	APN	11	77455407	missense	probably damaging	1.00
IGL02993:Ssh2	APN	11	77453544	missense	probably damaging	1.00
IGL03000:Ssh2	APN	11	77421206	splice site	probably benign
david	UTSW	11	77425593	missense	probably damaging	1.00
faba	UTSW	11	77441985	missense	probably damaging	1.00
goliath	UTSW	11	77453523	missense	possibly damaging	0.48
Vicia	UTSW	11	77454966	missense	possibly damaging	0.68
IGL03055:Ssh2	UTSW	11	77408195	nonsense	probably null
R0024:Ssh2	UTSW	11	77454966	missense	possibly damaging	0.68
R0374:Ssh2	UTSW	11	77408143	missense	probably damaging	1.00
R0539:Ssh2	UTSW	11	77454794	missense	probably benign	0.11
R0834:Ssh2	UTSW	11	77437633	missense	possibly damaging	0.87
R1714:Ssh2	UTSW	11	77454024	missense	possibly damaging	0.94
R1743:Ssh2	UTSW	11	77437756	missense	probably damaging	1.00
R1889:Ssh2	UTSW	11	77449745	missense	probably damaging	1.00
R1895:Ssh2	UTSW	11	77449745	missense	probably damaging	1.00
R3945:Ssh2	UTSW	11	77454668	missense	possibly damaging	0.93
R3947:Ssh2	UTSW	11	77398256	missense	probably damaging	0.99
R3948:Ssh2	UTSW	11	77398256	missense	probably damaging	0.99
R4133:Ssh2	UTSW	11	77421269	missense	probably damaging	1.00
R4256:Ssh2	UTSW	11	77408183	missense	possibly damaging	0.48
R4499:Ssh2	UTSW	11	77393067	nonsense	probably null
R4548:Ssh2	UTSW	11	77450184	missense	probably benign	0.20
R4644:Ssh2	UTSW	11	77449576	missense	possibly damaging	0.46
R4690:Ssh2	UTSW	11	77455205	missense	possibly damaging	0.62
R4788:Ssh2	UTSW	11	77429798	missense	probably damaging	1.00
R4919:Ssh2	UTSW	11	77425320	missense	possibly damaging	0.91
R5014:Ssh2	UTSW	11	77455276	nonsense	probably null
R5380:Ssh2	UTSW	11	77453945	missense	probably benign	0.01
R5574:Ssh2	UTSW	11	77450115	missense	probably benign
R5593:Ssh2	UTSW	11	77421366	missense	probably damaging	0.99
R5739:Ssh2	UTSW	11	77449813	missense	probably damaging	1.00
R6180:Ssh2	UTSW	11	77453465	missense	probably benign	0.43
R6542:Ssh2	UTSW	11	77450150	missense	possibly damaging	0.94
R6713:Ssh2	UTSW	11	77449433	missense	possibly damaging	0.89
R7108:Ssh2	UTSW	11	77454794	missense	probably benign
R7124:Ssh2	UTSW	11	77454338	missense	probably benign	0.00
R7255:Ssh2	UTSW	11	77425593	missense	probably damaging	1.00
R7332:Ssh2	UTSW	11	77453523	missense	possibly damaging	0.48
R7362:Ssh2	UTSW	11	77449650	missense	probably benign	0.01
R7412:Ssh2	UTSW	11	77450108	missense	probably damaging	0.98
R7493:Ssh2	UTSW	11	77437716	missense	probably benign	0.16
R7686:Ssh2	UTSW	11	77425324	missense	possibly damaging	0.89
R7870:Ssh2	UTSW	11	77453615	missense	probably benign
R7895:Ssh2	UTSW	11	77454626	missense	probably benign	0.41
R7963:Ssh2	UTSW	11	77421356	missense	possibly damaging	0.93
R8030:Ssh2	UTSW	11	77454506	missense	probably benign	0.01
R8065:Ssh2	UTSW	11	77441985	missense	probably damaging	1.00
R8099:Ssh2	UTSW	11	77454929	nonsense	probably null
R8294:Ssh2	UTSW	11	77454201	missense	probably benign	0.08
R8464:Ssh2	UTSW	11	77454253	nonsense	probably null
R8469:Ssh2	UTSW	11	77449608	missense	probably benign	0.41
R8547:Ssh2	UTSW	11	77449707	missense	probably benign	0.10
R8677:Ssh2	UTSW	11	77455193	missense	possibly damaging	0.77
R8758:Ssh2	UTSW	11	77454017	missense	probably benign
R9029:Ssh2	UTSW	11	77437628	missense	probably damaging	1.00
R9030:Ssh2	UTSW	11	77421236	missense	possibly damaging	0.63
R9126:Ssh2	UTSW	11	77455276	nonsense	probably null
R9146:Ssh2	UTSW	11	77437676	missense	probably damaging	0.98
R9377:Ssh2	UTSW	11	77408148	missense	possibly damaging	0.95
R9483:Ssh2	UTSW	11	77393150	missense	possibly damaging	0.81
R9615:Ssh2	UTSW	11	77425377	missense	possibly damaging	0.48
RF018:Ssh2	UTSW	11	77454054	missense	probably damaging	0.99
X0017:Ssh2	UTSW	11	77441898	missense	probably damaging	1.00
Z1088:Ssh2	UTSW	11	77449495	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTCTCCTCTTGAATTTGTTAGGA -3'
(R):5'- AACCACCAAATTTAAGGCAAAAGGT -3'

Sequencing Primer
(F):5'- TATATCCCAGAGTAGCCTTGAGC -3'
(R):5'- AAGACTCAGTCCACTTTGGG -3'

Posted On

2019-09-13