Incidental Mutation 'R7395:Ssh2'
ID 573761
Institutional Source Beutler Lab
Gene Symbol Ssh2
Ensembl Gene ENSMUSG00000037926
Gene Name slingshot protein phosphatase 2
Synonyms SSH-2
MMRRC Submission 045477-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.262) question?
Stock # R7395 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 77107113-77351046 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 77283899 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 51 (V51A)
Ref Sequence ENSEMBL: ENSMUSP00000137933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037912] [ENSMUST00000156488] [ENSMUST00000181283]
AlphaFold Q5SW75
Predicted Effect probably damaging
Transcript: ENSMUST00000037912
AA Change: V44A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042625
Gene: ENSMUSG00000037926
AA Change: V44A

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
Pfam:DEK_C 251 302 3.1e-13 PFAM
DSPc 307 445 2.2e-41 SMART
low complexity region 459 469 N/A INTRINSIC
low complexity region 871 882 N/A INTRINSIC
low complexity region 1002 1014 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000156488
AA Change: V71A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000119681
Gene: ENSMUSG00000037926
AA Change: V71A

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000181283
AA Change: V51A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000137933
Gene: ENSMUSG00000037926
AA Change: V51A

DomainStartEndE-ValueType
Pfam:DEK_C 256 309 1.7e-18 PFAM
DSPc 313 451 2.2e-41 SMART
low complexity region 465 475 N/A INTRINSIC
low complexity region 877 888 N/A INTRINSIC
low complexity region 1008 1020 N/A INTRINSIC
low complexity region 1376 1391 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein tyrosine phosphatase that plays a key role in the regulation of actin filaments. The encoded protein dephosphorylates and activates cofilin, which promotes actin filament depolymerization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 55,184,140 (GRCm39) probably null Het
4930433I11Rik A T 7: 40,639,102 (GRCm39) T13S probably damaging Het
Abca13 A G 11: 9,241,658 (GRCm39) I1174V probably benign Het
Acoxl G A 2: 127,726,336 (GRCm39) V237M probably damaging Het
Adam33 A C 2: 130,903,089 (GRCm39) W52G probably benign Het
Adgrv1 T C 13: 81,707,467 (GRCm39) H1313R probably damaging Het
Ap3d1 T C 10: 80,566,716 (GRCm39) T89A probably benign Het
Armc8 T C 9: 99,415,185 (GRCm39) E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,949 (GRCm39) *383Q probably null Het
Atp8b4 A T 2: 126,217,614 (GRCm39) L634Q possibly damaging Het
B3glct A G 5: 149,649,069 (GRCm39) probably null Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Bicd2 A G 13: 49,531,706 (GRCm39) D316G possibly damaging Het
Bop1 A T 15: 76,338,041 (GRCm39) S610T probably damaging Het
Car11 T A 7: 45,350,745 (GRCm39) Y80* probably null Het
Ccdc121rt2 A T 5: 112,598,035 (GRCm39) E194V possibly damaging Het
Ccdc96 T C 5: 36,642,609 (GRCm39) I205T probably benign Het
Ces2a A G 8: 105,466,273 (GRCm39) E390G probably benign Het
Cfap54 C A 10: 92,720,565 (GRCm39) V2630L unknown Het
Chek2 G T 5: 111,019,974 (GRCm39) probably null Het
Cntn3 C T 6: 102,314,355 (GRCm39) probably null Het
Cpne3 A T 4: 19,528,239 (GRCm39) D339E probably damaging Het
Crocc2 C T 1: 93,143,829 (GRCm39) Q1403* probably null Het
Crppa A T 12: 36,551,994 (GRCm39) I283F possibly damaging Het
Csnka2ip G A 16: 64,299,803 (GRCm39) T187I Het
Ctu1 A G 7: 43,326,019 (GRCm39) H226R possibly damaging Het
Cubn G T 2: 13,291,875 (GRCm39) Q3317K probably damaging Het
Cyp17a1 A G 19: 46,659,134 (GRCm39) L169P probably benign Het
Dcc T A 18: 71,507,640 (GRCm39) K911* probably null Het
Dcun1d2 G A 8: 13,328,675 (GRCm39) R75* probably null Het
Defb19 A T 2: 152,421,943 (GRCm39) probably null Het
Dffb A T 4: 154,053,570 (GRCm39) S257R probably damaging Het
Dip2c A C 13: 9,664,413 (GRCm39) N942T probably damaging Het
Dnah3 T A 7: 119,565,474 (GRCm39) I169F Het
Dnah3 T C 7: 119,660,183 (GRCm39) M830V probably benign Het
Dnajc5g G A 5: 31,269,009 (GRCm39) S130N possibly damaging Het
Dscaml1 C A 9: 45,613,703 (GRCm39) Q939K possibly damaging Het
Evpl G C 11: 116,117,905 (GRCm39) N761K possibly damaging Het
Fbxw8 A T 5: 118,206,280 (GRCm39) I556N probably damaging Het
Fry G T 5: 150,304,348 (GRCm39) M579I possibly damaging Het
Ggt7 A T 2: 155,337,800 (GRCm39) M488K probably benign Het
Gnpnat1 T A 14: 45,619,038 (GRCm39) H107L probably benign Het
Golga2 C A 2: 32,195,599 (GRCm39) P798Q possibly damaging Het
Gpr35 G A 1: 92,910,929 (GRCm39) A214T probably damaging Het
Greb1 A T 12: 16,759,431 (GRCm39) probably null Het
Hdac10 G A 15: 89,012,487 (GRCm39) T32I probably benign Het
Hkdc1 G A 10: 62,221,478 (GRCm39) T860I probably damaging Het
Icam5 C A 9: 20,946,738 (GRCm39) P422Q possibly damaging Het
Ist1 A C 8: 110,404,159 (GRCm39) S238A probably benign Het
Lrig2 T C 3: 104,404,836 (GRCm39) N91D probably benign Het
Mapt A C 11: 104,218,949 (GRCm39) D352A probably damaging Het
Micall2 G A 5: 139,702,124 (GRCm39) P373L possibly damaging Het
Mocs1 A G 17: 49,761,585 (GRCm39) S560G possibly damaging Het
Mpo A G 11: 87,691,950 (GRCm39) D461G probably damaging Het
Myo1a G T 10: 127,546,309 (GRCm39) V271L probably damaging Het
Ncoa1 G A 12: 4,345,188 (GRCm39) P720S not run Het
Ncr1 T A 7: 4,341,150 (GRCm39) I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 (GRCm39) R66C probably damaging Het
Obox5 A T 7: 15,492,668 (GRCm39) S208C probably damaging Het
Or10q1 T C 19: 13,726,502 (GRCm39) S11P probably damaging Het
Or2n1d A T 17: 38,646,755 (GRCm39) K236* probably null Het
Or5p75-ps1 T A 7: 108,107,611 (GRCm39) F116Y unknown Het
Or7d9 T A 9: 20,197,826 (GRCm39) M285K probably damaging Het
Padi4 A C 4: 140,488,983 (GRCm39) V152G probably damaging Het
Pdzd7 A T 19: 45,025,450 (GRCm39) D348E probably damaging Het
Pdzph1 T A 17: 59,186,154 (GRCm39) K1212N possibly damaging Het
Piezo2 C T 18: 63,160,634 (GRCm39) G2341R probably damaging Het
Plb1 A G 5: 32,511,028 (GRCm39) K1298E probably benign Het
Prr14l A G 5: 32,985,982 (GRCm39) L1171P probably benign Het
Rab11fip5 T C 6: 85,318,850 (GRCm39) T680A probably benign Het
Rev1 A T 1: 38,127,146 (GRCm39) N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,133 (GRCm39) probably benign Het
Ryr2 A G 13: 11,799,997 (GRCm39) C917R probably damaging Het
Sall1 A T 8: 89,757,549 (GRCm39) S852T possibly damaging Het
Serpine2 A G 1: 79,779,272 (GRCm39) F296L probably damaging Het
Slc12a6 A T 2: 112,182,887 (GRCm39) N754I probably damaging Het
Slc39a6 A T 18: 24,718,332 (GRCm39) L575Q probably damaging Het
Smarcc2 T A 10: 128,321,475 (GRCm39) L890Q probably damaging Het
Smg5 T A 3: 88,268,378 (GRCm39) V1006D probably damaging Het
St14 T C 9: 31,008,195 (GRCm39) K547E probably benign Het
Stag1 T G 9: 100,678,781 (GRCm39) V234G probably damaging Het
Stag3 A T 5: 138,280,207 (GRCm39) Q24L probably benign Het
Stra6 T C 9: 58,048,380 (GRCm39) Y158H probably damaging Het
Tcstv1a A T 13: 120,355,666 (GRCm39) probably null Het
Tmem196 G A 12: 119,975,002 (GRCm39) C62Y probably damaging Het
Tmem265 T A 7: 127,164,039 (GRCm39) F84L Het
Tph1 C T 7: 46,306,627 (GRCm39) probably null Het
Ttn A G 2: 76,776,834 (GRCm39) I1522T unknown Het
Ulk4 T A 9: 121,084,178 (GRCm39) Q129L probably benign Het
Usp17la T A 7: 104,510,792 (GRCm39) S466T probably benign Het
Vmn2r31 A T 7: 7,387,744 (GRCm39) V609E probably damaging Het
Vmn2r52 C T 7: 9,904,744 (GRCm39) C365Y probably benign Het
Zbtb4 A T 11: 69,666,937 (GRCm39) T81S possibly damaging Het
Zfp605 A T 5: 110,259,885 (GRCm39) probably benign Het
Other mutations in Ssh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00811:Ssh2 APN 11 77,332,752 (GRCm39) missense probably damaging 1.00
IGL01141:Ssh2 APN 11 77,340,552 (GRCm39) missense probably damaging 1.00
IGL01520:Ssh2 APN 11 77,340,732 (GRCm39) missense probably damaging 1.00
IGL01803:Ssh2 APN 11 77,316,156 (GRCm39) missense probably damaging 0.99
IGL01989:Ssh2 APN 11 77,344,511 (GRCm39) missense possibly damaging 0.79
IGL02322:Ssh2 APN 11 77,307,239 (GRCm39) critical splice acceptor site probably null
IGL02466:Ssh2 APN 11 77,307,233 (GRCm39) splice site probably benign
IGL02683:Ssh2 APN 11 77,289,082 (GRCm39) missense probably damaging 0.99
IGL02706:Ssh2 APN 11 77,344,232 (GRCm39) missense possibly damaging 0.68
IGL02719:Ssh2 APN 11 77,316,413 (GRCm39) missense probably damaging 1.00
IGL02721:Ssh2 APN 11 77,345,551 (GRCm39) nonsense probably null
IGL02732:Ssh2 APN 11 77,328,602 (GRCm39) splice site probably null
IGL02745:Ssh2 APN 11 77,346,233 (GRCm39) missense probably damaging 1.00
IGL02993:Ssh2 APN 11 77,344,370 (GRCm39) missense probably damaging 1.00
IGL03000:Ssh2 APN 11 77,312,032 (GRCm39) splice site probably benign
david UTSW 11 77,316,419 (GRCm39) missense probably damaging 1.00
faba UTSW 11 77,332,811 (GRCm39) missense probably damaging 1.00
goliath UTSW 11 77,344,349 (GRCm39) missense possibly damaging 0.48
Vicia UTSW 11 77,345,792 (GRCm39) missense possibly damaging 0.68
IGL03055:Ssh2 UTSW 11 77,299,021 (GRCm39) nonsense probably null
R0024:Ssh2 UTSW 11 77,345,792 (GRCm39) missense possibly damaging 0.68
R0374:Ssh2 UTSW 11 77,298,969 (GRCm39) missense probably damaging 1.00
R0539:Ssh2 UTSW 11 77,345,620 (GRCm39) missense probably benign 0.11
R0834:Ssh2 UTSW 11 77,328,459 (GRCm39) missense possibly damaging 0.87
R1714:Ssh2 UTSW 11 77,344,850 (GRCm39) missense possibly damaging 0.94
R1743:Ssh2 UTSW 11 77,328,582 (GRCm39) missense probably damaging 1.00
R1889:Ssh2 UTSW 11 77,340,571 (GRCm39) missense probably damaging 1.00
R1895:Ssh2 UTSW 11 77,340,571 (GRCm39) missense probably damaging 1.00
R3945:Ssh2 UTSW 11 77,345,494 (GRCm39) missense possibly damaging 0.93
R3947:Ssh2 UTSW 11 77,289,082 (GRCm39) missense probably damaging 0.99
R3948:Ssh2 UTSW 11 77,289,082 (GRCm39) missense probably damaging 0.99
R4133:Ssh2 UTSW 11 77,312,095 (GRCm39) missense probably damaging 1.00
R4256:Ssh2 UTSW 11 77,299,009 (GRCm39) missense possibly damaging 0.48
R4499:Ssh2 UTSW 11 77,283,893 (GRCm39) nonsense probably null
R4548:Ssh2 UTSW 11 77,341,010 (GRCm39) missense probably benign 0.20
R4644:Ssh2 UTSW 11 77,340,402 (GRCm39) missense possibly damaging 0.46
R4690:Ssh2 UTSW 11 77,346,031 (GRCm39) missense possibly damaging 0.62
R4788:Ssh2 UTSW 11 77,320,624 (GRCm39) missense probably damaging 1.00
R4919:Ssh2 UTSW 11 77,316,146 (GRCm39) missense possibly damaging 0.91
R5014:Ssh2 UTSW 11 77,346,102 (GRCm39) nonsense probably null
R5380:Ssh2 UTSW 11 77,344,771 (GRCm39) missense probably benign 0.01
R5574:Ssh2 UTSW 11 77,340,941 (GRCm39) missense probably benign
R5593:Ssh2 UTSW 11 77,312,192 (GRCm39) missense probably damaging 0.99
R5739:Ssh2 UTSW 11 77,340,639 (GRCm39) missense probably damaging 1.00
R6180:Ssh2 UTSW 11 77,344,291 (GRCm39) missense probably benign 0.43
R6542:Ssh2 UTSW 11 77,340,976 (GRCm39) missense possibly damaging 0.94
R6713:Ssh2 UTSW 11 77,340,259 (GRCm39) missense possibly damaging 0.89
R7108:Ssh2 UTSW 11 77,345,620 (GRCm39) missense probably benign
R7124:Ssh2 UTSW 11 77,345,164 (GRCm39) missense probably benign 0.00
R7255:Ssh2 UTSW 11 77,316,419 (GRCm39) missense probably damaging 1.00
R7332:Ssh2 UTSW 11 77,344,349 (GRCm39) missense possibly damaging 0.48
R7362:Ssh2 UTSW 11 77,340,476 (GRCm39) missense probably benign 0.01
R7412:Ssh2 UTSW 11 77,340,934 (GRCm39) missense probably damaging 0.98
R7493:Ssh2 UTSW 11 77,328,542 (GRCm39) missense probably benign 0.16
R7686:Ssh2 UTSW 11 77,316,150 (GRCm39) missense possibly damaging 0.89
R7870:Ssh2 UTSW 11 77,344,441 (GRCm39) missense probably benign
R7895:Ssh2 UTSW 11 77,345,452 (GRCm39) missense probably benign 0.41
R7963:Ssh2 UTSW 11 77,312,182 (GRCm39) missense possibly damaging 0.93
R8030:Ssh2 UTSW 11 77,345,332 (GRCm39) missense probably benign 0.01
R8065:Ssh2 UTSW 11 77,332,811 (GRCm39) missense probably damaging 1.00
R8099:Ssh2 UTSW 11 77,345,755 (GRCm39) nonsense probably null
R8294:Ssh2 UTSW 11 77,345,027 (GRCm39) missense probably benign 0.08
R8464:Ssh2 UTSW 11 77,345,079 (GRCm39) nonsense probably null
R8469:Ssh2 UTSW 11 77,340,434 (GRCm39) missense probably benign 0.41
R8547:Ssh2 UTSW 11 77,340,533 (GRCm39) missense probably benign 0.10
R8677:Ssh2 UTSW 11 77,346,019 (GRCm39) missense possibly damaging 0.77
R8758:Ssh2 UTSW 11 77,344,843 (GRCm39) missense probably benign
R9029:Ssh2 UTSW 11 77,328,454 (GRCm39) missense probably damaging 1.00
R9030:Ssh2 UTSW 11 77,312,062 (GRCm39) missense possibly damaging 0.63
R9126:Ssh2 UTSW 11 77,346,102 (GRCm39) nonsense probably null
R9146:Ssh2 UTSW 11 77,328,502 (GRCm39) missense probably damaging 0.98
R9377:Ssh2 UTSW 11 77,298,974 (GRCm39) missense possibly damaging 0.95
R9483:Ssh2 UTSW 11 77,283,976 (GRCm39) missense possibly damaging 0.81
R9615:Ssh2 UTSW 11 77,316,203 (GRCm39) missense possibly damaging 0.48
RF018:Ssh2 UTSW 11 77,344,880 (GRCm39) missense probably damaging 0.99
X0017:Ssh2 UTSW 11 77,332,724 (GRCm39) missense probably damaging 1.00
Z1088:Ssh2 UTSW 11 77,340,321 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTCTCCTCTTGAATTTGTTAGGA -3'
(R):5'- AACCACCAAATTTAAGGCAAAAGGT -3'

Sequencing Primer
(F):5'- TATATCCCAGAGTAGCCTTGAGC -3'
(R):5'- AAGACTCAGTCCACTTTGGG -3'
Posted On 2019-09-13