Incidental Mutation 'R7395:Mapt'
ID573763
Institutional Source Beutler Lab
Gene Symbol Mapt
Ensembl Gene ENSMUSG00000018411
Gene Namemicrotubule-associated protein tau
SynonymsMtapt, Tau
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7395 (G1)
Quality Score182.009
Status Validated
Chromosome11
Chromosomal Location104231390-104332090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104328123 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 352 (D352A)
Ref Sequence ENSEMBL: ENSMUSP00000102605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100347] [ENSMUST00000106988] [ENSMUST00000106989] [ENSMUST00000106992] [ENSMUST00000106993]
Predicted Effect probably damaging
Transcript: ENSMUST00000100347
AA Change: D410A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097919
Gene: ENSMUSG00000018411
AA Change: D410A

DomainStartEndE-ValueType
low complexity region 127 139 N/A INTRINSIC
low complexity region 163 212 N/A INTRINSIC
Pfam:Tubulin-binding 232 263 1.4e-18 PFAM
Pfam:Tubulin-binding 264 294 3.3e-21 PFAM
Pfam:Tubulin-binding 295 325 1.6e-19 PFAM
Pfam:Tubulin-binding 326 357 1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106988
AA Change: D713A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102601
Gene: ENSMUSG00000018411
AA Change: D713A

DomainStartEndE-ValueType
low complexity region 188 202 N/A INTRINSIC
low complexity region 261 274 N/A INTRINSIC
low complexity region 466 515 N/A INTRINSIC
Pfam:Tubulin-binding 535 566 3.5e-19 PFAM
Pfam:Tubulin-binding 567 597 8.6e-22 PFAM
Pfam:Tubulin-binding 598 628 4e-20 PFAM
Pfam:Tubulin-binding 629 660 2.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106989
AA Change: D729A

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102602
Gene: ENSMUSG00000018411
AA Change: D729A

DomainStartEndE-ValueType
low complexity region 204 218 N/A INTRINSIC
low complexity region 277 290 N/A INTRINSIC
low complexity region 482 531 N/A INTRINSIC
Pfam:Tubulin-binding 552 582 1.7e-13 PFAM
Pfam:Tubulin-binding 583 613 6.8e-20 PFAM
Pfam:Tubulin-binding 614 644 2.3e-17 PFAM
Pfam:Tubulin-binding 645 676 3.1e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106992
AA Change: D352A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102605
Gene: ENSMUSG00000018411
AA Change: D352A

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 105 154 N/A INTRINSIC
Pfam:Tubulin-binding 174 205 6.1e-19 PFAM
Pfam:Tubulin-binding 206 236 1.5e-21 PFAM
Pfam:Tubulin-binding 237 267 6.9e-20 PFAM
Pfam:Tubulin-binding 268 299 4.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106993
AA Change: D370A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102606
Gene: ENSMUSG00000018411
AA Change: D370A

DomainStartEndE-ValueType
low complexity region 69 81 N/A INTRINSIC
low complexity region 103 119 N/A INTRINSIC
low complexity region 140 172 N/A INTRINSIC
Pfam:Tubulin-binding 192 223 4.6e-19 PFAM
Pfam:Tubulin-binding 224 254 1.1e-21 PFAM
Pfam:Tubulin-binding 255 285 5.3e-20 PFAM
Pfam:Tubulin-binding 286 317 3.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the microtubule-associated protein tau (MAPT) whose transcript undergoes complex, regulated alternative splicing, giving rise to several mRNA species. MAPT transcripts are differentially expressed in the nervous system, depending on stage of neuronal maturation and neuron type. MAPT gene mutations have been associated with several neurodegenerative disorders such as Alzheimer's disease, Pick's disease, frontotemporal dementia, cortico-basal degeneration and progressive supranuclear palsy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit altered performance in behavioral tests and show mircotubule changes in small-calibre axons. Embryonic hippocampal cultures from mutants exhibit delayed axonal and neuritic maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
4930433I11Rik A T 7: 40,989,678 T13S probably damaging Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
B3glct A G 5: 149,725,604 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dcun1d2 G A 8: 13,278,675 R75* probably null Het
Defb19 A T 2: 152,580,023 probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tcstv1 A T 13: 119,894,130 probably null Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Tph1 C T 7: 46,657,203 probably null Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Ulk4 T A 9: 121,255,112 Q129L probably benign Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Mapt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Mapt APN 11 104322485 missense probably damaging 1.00
IGL00473:Mapt APN 11 104287183 missense probably damaging 1.00
IGL01599:Mapt APN 11 104294915 missense probably damaging 1.00
IGL01862:Mapt APN 11 104290002 intron probably benign
IGL02315:Mapt APN 11 104328078 missense probably damaging 0.99
IGL03369:Mapt APN 11 104282433 missense probably damaging 1.00
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R0040:Mapt UTSW 11 104305398 missense probably damaging 0.97
R1913:Mapt UTSW 11 104328075 missense probably damaging 1.00
R1918:Mapt UTSW 11 104298499 missense probably benign 0.26
R3423:Mapt UTSW 11 104298722 nonsense probably null
R3425:Mapt UTSW 11 104298722 nonsense probably null
R3831:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R3833:Mapt UTSW 11 104287135 missense possibly damaging 0.89
R4095:Mapt UTSW 11 104310536 critical splice donor site probably null
R4814:Mapt UTSW 11 104298960 missense probably benign 0.04
R4890:Mapt UTSW 11 104328149 missense probably damaging 1.00
R5613:Mapt UTSW 11 104302390 missense possibly damaging 0.82
R6415:Mapt UTSW 11 104298998 missense probably benign 0.01
R6956:Mapt UTSW 11 104318255 splice site probably null
R7406:Mapt UTSW 11 104322524 missense possibly damaging 0.94
R7547:Mapt UTSW 11 104322312 splice site probably null
R7554:Mapt UTSW 11 104298702 missense probably benign 0.09
R7555:Mapt UTSW 11 104298702 missense probably benign 0.09
R7556:Mapt UTSW 11 104298702 missense probably benign 0.09
R8285:Mapt UTSW 11 104298802 missense probably benign 0.01
R8694:Mapt UTSW 11 104298614 missense probably benign
R8841:Mapt UTSW 11 104310377 missense probably damaging 1.00
R8942:Mapt UTSW 11 104282481 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGACTAGCTCTGGTGTATAGAACC -3'
(R):5'- GGTTAGGTGACAAGCAGGTC -3'

Sequencing Primer
(F):5'- CTAGCTCTGGTGTATAGAACCTTATC -3'
(R):5'- ATTATTGACTGCCCTGGG -3'
Posted On2019-09-13