Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Evpl'

573764

Institutional Source

Beutler Lab

Gene Symbol

Evpl

Ensembl Gene

ENSMUSG00000034282

Gene Name

envoplakin

Synonyms

210kDa protein

MMRRC Submission

Accession Numbers

Genbank: NM_025276; MGI: 107507

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

116220559-116238077 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 116227079 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 761 (N761K)

Ref Sequence

ENSEMBL: ENSMUSP00000037850 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037007]

AlphaFold

Q9D952

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037007
AA Change: N761K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: N761K

Domain	Start	End	E-Value	Type
low complexity region	3	30	N/A	INTRINSIC
Blast:SPEC	44	140	1e-16	BLAST
Blast:SPEC	140	226	4e-46	BLAST
SPEC	229	330	2.21e-6	SMART
Blast:SPEC	336	500	7e-68	BLAST
low complexity region	508	525	N/A	INTRINSIC
Blast:SPEC	527	632	4e-41	BLAST
Blast:SPEC	635	746	5e-48	BLAST
Blast:SPEC	753	867	7e-49	BLAST
low complexity region	868	881	N/A	INTRINSIC
low complexity region	933	950	N/A	INTRINSIC
internal_repeat_2	1011	1030	6.54e-6	PROSPERO
internal_repeat_3	1012	1032	1.94e-5	PROSPERO
coiled coil region	1035	1077	N/A	INTRINSIC
low complexity region	1131	1144	N/A	INTRINSIC
low complexity region	1149	1164	N/A	INTRINSIC
PLEC	1186	1227	1.48e2	SMART
low complexity region	1228	1242	N/A	INTRINSIC
coiled coil region	1262	1366	N/A	INTRINSIC
low complexity region	1398	1414	N/A	INTRINSIC
internal_repeat_2	1457	1476	6.54e-6	PROSPERO
internal_repeat_3	1516	1536	1.94e-5	PROSPERO
low complexity region	1595	1617	N/A	INTRINSIC
PLEC	1679	1714	9.19e-4	SMART
PLEC	1729	1764	4.53e1	SMART
low complexity region	1788	1800	N/A	INTRINSIC
PLEC	1819	1856	1.41e-4	SMART
PLEC	1857	1894	5.4e-10	SMART
PLEC	1895	1932	2.7e-10	SMART
PLEC	1933	1970	1.21e-3	SMART
PLEC	1971	2008	1.16e0	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Evpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00427:Evpl	APN	11	116234505	missense	probably benign	0.01
IGL00896:Evpl	APN	11	116222584	nonsense	probably null
IGL00941:Evpl	APN	11	116227901	missense	probably benign	0.06
IGL01443:Evpl	APN	11	116222454	missense	probably damaging	1.00
IGL01523:Evpl	APN	11	116233444	missense	probably damaging	1.00
IGL01957:Evpl	APN	11	116223222	missense	probably damaging	1.00
IGL02124:Evpl	APN	11	116227015	missense	probably benign	0.01
IGL02334:Evpl	APN	11	116231024	nonsense	probably null
IGL02457:Evpl	APN	11	116230113	missense	possibly damaging	0.87
IGL02502:Evpl	APN	11	116222718	missense	probably damaging	1.00
IGL02536:Evpl	APN	11	116221209	missense	probably damaging	1.00
IGL02948:Evpl	APN	11	116221822	missense	probably damaging	1.00
IGL03183:Evpl	APN	11	116221612	missense	probably damaging	0.98
IGL03405:Evpl	APN	11	116227927	missense	possibly damaging	0.89
A4554:Evpl	UTSW	11	116220834	missense	probably damaging	1.00
BB005:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
BB015:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
PIT4449001:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R0082:Evpl	UTSW	11	116235003	missense	probably damaging	1.00
R0108:Evpl	UTSW	11	116220876	missense	probably damaging	1.00
R0514:Evpl	UTSW	11	116223291	missense	probably damaging	0.99
R0581:Evpl	UTSW	11	116229490	missense	probably benign	0.02
R0727:Evpl	UTSW	11	116232485	missense	probably damaging	1.00
R0791:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R0792:Evpl	UTSW	11	116227723	missense	probably damaging	1.00
R1079:Evpl	UTSW	11	116230068	missense	possibly damaging	0.48
R1514:Evpl	UTSW	11	116223835	missense	probably benign
R1699:Evpl	UTSW	11	116227588	missense	probably damaging	1.00
R1717:Evpl	UTSW	11	116225492	missense	probably benign	0.06
R1775:Evpl	UTSW	11	116223660	missense	possibly damaging	0.66
R1886:Evpl	UTSW	11	116227576	missense	probably damaging	0.97
R1903:Evpl	UTSW	11	116227028	missense	probably damaging	1.00
R2081:Evpl	UTSW	11	116234266	missense	probably damaging	1.00
R2137:Evpl	UTSW	11	116221839	missense	probably damaging	0.99
R2571:Evpl	UTSW	11	116237969	missense	unknown
R3081:Evpl	UTSW	11	116220852	missense	probably damaging	1.00
R4097:Evpl	UTSW	11	116223177	missense	possibly damaging	0.89
R4541:Evpl	UTSW	11	116232644	missense	probably benign	0.01
R4562:Evpl	UTSW	11	116233399	missense	possibly damaging	0.87
R4703:Evpl	UTSW	11	116222505	missense	probably damaging	0.98
R4947:Evpl	UTSW	11	116223375	missense	possibly damaging	0.88
R5243:Evpl	UTSW	11	116222969	missense	probably damaging	1.00
R5325:Evpl	UTSW	11	116221365	missense	probably damaging	1.00
R5416:Evpl	UTSW	11	116234259	missense	probably benign	0.13
R5580:Evpl	UTSW	11	116234232	missense	probably benign	0.14
R5873:Evpl	UTSW	11	116234432	missense	probably damaging	1.00
R6298:Evpl	UTSW	11	116230922	missense	probably damaging	1.00
R6438:Evpl	UTSW	11	116230101	missense	probably benign	0.00
R6742:Evpl	UTSW	11	116222814	missense	possibly damaging	0.80
R6753:Evpl	UTSW	11	116237906	missense	possibly damaging	0.95
R6764:Evpl	UTSW	11	116222944	missense	probably damaging	0.99
R6846:Evpl	UTSW	11	116223807	missense	probably damaging	1.00
R7278:Evpl	UTSW	11	116223113	missense	probably damaging	1.00
R7288:Evpl	UTSW	11	116223949	missense	probably benign
R7441:Evpl	UTSW	11	116222956	nonsense	probably null
R7505:Evpl	UTSW	11	116226987	critical splice donor site	probably null
R7674:Evpl	UTSW	11	116222568	missense	probably benign	0.40
R7772:Evpl	UTSW	11	116221435	missense	probably benign	0.00
R7780:Evpl	UTSW	11	116234174	missense	not run
R7861:Evpl	UTSW	11	116228069	missense	probably damaging	1.00
R7928:Evpl	UTSW	11	116222533	missense	possibly damaging	0.63
R8008:Evpl	UTSW	11	116230472	missense	probably null	0.21
R8040:Evpl	UTSW	11	116222932	missense	probably damaging	0.99
R8052:Evpl	UTSW	11	116223163	missense	probably benign	0.00
R8402:Evpl	UTSW	11	116225371	missense	probably benign	0.03
R8513:Evpl	UTSW	11	116229744	critical splice donor site	probably null
R8695:Evpl	UTSW	11	116223663	missense	probably benign	0.02
R8725:Evpl	UTSW	11	116222193	missense	probably benign	0.25
R8749:Evpl	UTSW	11	116229406	missense	probably benign	0.01
R8807:Evpl	UTSW	11	116221027	missense	probably damaging	1.00
R8883:Evpl	UTSW	11	116230417	missense	probably damaging	0.99
R8947:Evpl	UTSW	11	116221338	missense	probably damaging	1.00
R9123:Evpl	UTSW	11	116224182	missense	possibly damaging	0.62
R9314:Evpl	UTSW	11	116227677	missense	probably benign	0.13
R9581:Evpl	UTSW	11	116229834	missense	probably benign	0.30
R9665:Evpl	UTSW	11	116232671	missense	probably damaging	1.00
R9688:Evpl	UTSW	11	116234160	missense	probably damaging	1.00
R9756:Evpl	UTSW	11	116221251	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTTGGCCTCATGAATACAAG -3'
(R):5'- CACCGTTCATTGTGTCTGAGAC -3'

Sequencing Primer
(F):5'- GGCCTCATGAATACAAGCAGCTG -3'
(R):5'- GACACAATCTCTGTTAGCTGCAAGG -3'

Posted On

2019-09-13