Incidental Mutation 'R7395:Evpl'
ID573764
Institutional Source Beutler Lab
Gene Symbol Evpl
Ensembl Gene ENSMUSG00000034282
Gene Nameenvoplakin
Synonyms210kDa protein
MMRRC Submission
Accession Numbers

Genbank: NM_025276; MGI: 107507

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7395 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116220559-116238077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 116227079 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 761 (N761K)
Ref Sequence ENSEMBL: ENSMUSP00000037850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037007]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037007
AA Change: N761K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037850
Gene: ENSMUSG00000034282
AA Change: N761K

DomainStartEndE-ValueType
low complexity region 3 30 N/A INTRINSIC
Blast:SPEC 44 140 1e-16 BLAST
Blast:SPEC 140 226 4e-46 BLAST
SPEC 229 330 2.21e-6 SMART
Blast:SPEC 336 500 7e-68 BLAST
low complexity region 508 525 N/A INTRINSIC
Blast:SPEC 527 632 4e-41 BLAST
Blast:SPEC 635 746 5e-48 BLAST
Blast:SPEC 753 867 7e-49 BLAST
low complexity region 868 881 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
internal_repeat_2 1011 1030 6.54e-6 PROSPERO
internal_repeat_3 1012 1032 1.94e-5 PROSPERO
coiled coil region 1035 1077 N/A INTRINSIC
low complexity region 1131 1144 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
PLEC 1186 1227 1.48e2 SMART
low complexity region 1228 1242 N/A INTRINSIC
coiled coil region 1262 1366 N/A INTRINSIC
low complexity region 1398 1414 N/A INTRINSIC
internal_repeat_2 1457 1476 6.54e-6 PROSPERO
internal_repeat_3 1516 1536 1.94e-5 PROSPERO
low complexity region 1595 1617 N/A INTRINSIC
PLEC 1679 1714 9.19e-4 SMART
PLEC 1729 1764 4.53e1 SMART
low complexity region 1788 1800 N/A INTRINSIC
PLEC 1819 1856 1.41e-4 SMART
PLEC 1857 1894 5.4e-10 SMART
PLEC 1895 1932 2.7e-10 SMART
PLEC 1933 1970 1.21e-3 SMART
PLEC 1971 2008 1.16e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plakin family of proteins that forms a component of desmosomes and the epidermal cornified envelope. This gene is located in the tylosis oesophageal cancer locus on chromosome 17q25, and its deletion is associated with both familial and sporadic forms of oesophageal squamous cell carcinoma. Patients suffering from the autoimmune mucocutaneous disorder, paraneoplastic pemphigus, develop antibodies against the encoded protein. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted deletion of this gene are viable and fertile. Surprisingly, cornified envelope assembly is not inhibited and adult homozygotes show no obvious pathological phenotype in skin or other epithelia, despite a slight delay in barrier acquisition during embryonic development. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
4930433I11Rik A T 7: 40,989,678 T13S probably damaging Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
B3glct A G 5: 149,725,604 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dcun1d2 G A 8: 13,278,675 R75* probably null Het
Defb19 A T 2: 152,580,023 probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tcstv1 A T 13: 119,894,130 probably null Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Tph1 C T 7: 46,657,203 probably null Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Ulk4 T A 9: 121,255,112 Q129L probably benign Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Evpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Evpl APN 11 116234505 missense probably benign 0.01
IGL00896:Evpl APN 11 116222584 nonsense probably null
IGL00941:Evpl APN 11 116227901 missense probably benign 0.06
IGL01443:Evpl APN 11 116222454 missense probably damaging 1.00
IGL01523:Evpl APN 11 116233444 missense probably damaging 1.00
IGL01957:Evpl APN 11 116223222 missense probably damaging 1.00
IGL02124:Evpl APN 11 116227015 missense probably benign 0.01
IGL02334:Evpl APN 11 116231024 nonsense probably null
IGL02457:Evpl APN 11 116230113 missense possibly damaging 0.87
IGL02502:Evpl APN 11 116222718 missense probably damaging 1.00
IGL02536:Evpl APN 11 116221209 missense probably damaging 1.00
IGL02948:Evpl APN 11 116221822 missense probably damaging 1.00
IGL03183:Evpl APN 11 116221612 missense probably damaging 0.98
IGL03405:Evpl APN 11 116227927 missense possibly damaging 0.89
A4554:Evpl UTSW 11 116220834 missense probably damaging 1.00
PIT4449001:Evpl UTSW 11 116233399 missense possibly damaging 0.87
R0082:Evpl UTSW 11 116235003 missense probably damaging 1.00
R0108:Evpl UTSW 11 116220876 missense probably damaging 1.00
R0514:Evpl UTSW 11 116223291 missense probably damaging 0.99
R0581:Evpl UTSW 11 116229490 missense probably benign 0.02
R0727:Evpl UTSW 11 116232485 missense probably damaging 1.00
R0791:Evpl UTSW 11 116227723 missense probably damaging 1.00
R0792:Evpl UTSW 11 116227723 missense probably damaging 1.00
R1079:Evpl UTSW 11 116230068 missense possibly damaging 0.48
R1514:Evpl UTSW 11 116223835 missense probably benign
R1699:Evpl UTSW 11 116227588 missense probably damaging 1.00
R1717:Evpl UTSW 11 116225492 missense probably benign 0.06
R1775:Evpl UTSW 11 116223660 missense possibly damaging 0.66
R1886:Evpl UTSW 11 116227576 missense probably damaging 0.97
R1903:Evpl UTSW 11 116227028 missense probably damaging 1.00
R2081:Evpl UTSW 11 116234266 missense probably damaging 1.00
R2137:Evpl UTSW 11 116221839 missense probably damaging 0.99
R2571:Evpl UTSW 11 116237969 missense unknown
R3081:Evpl UTSW 11 116220852 missense probably damaging 1.00
R4097:Evpl UTSW 11 116223177 missense possibly damaging 0.89
R4541:Evpl UTSW 11 116232644 missense probably benign 0.01
R4562:Evpl UTSW 11 116233399 missense possibly damaging 0.87
R4703:Evpl UTSW 11 116222505 missense probably damaging 0.98
R4947:Evpl UTSW 11 116223375 missense possibly damaging 0.88
R5243:Evpl UTSW 11 116222969 missense probably damaging 1.00
R5325:Evpl UTSW 11 116221365 missense probably damaging 1.00
R5416:Evpl UTSW 11 116234259 missense probably benign 0.13
R5580:Evpl UTSW 11 116234232 missense probably benign 0.14
R5873:Evpl UTSW 11 116234432 missense probably damaging 1.00
R6298:Evpl UTSW 11 116230922 missense probably damaging 1.00
R6438:Evpl UTSW 11 116230101 missense probably benign 0.00
R6742:Evpl UTSW 11 116222814 missense possibly damaging 0.80
R6753:Evpl UTSW 11 116237906 missense possibly damaging 0.95
R6764:Evpl UTSW 11 116222944 missense probably damaging 0.99
R6846:Evpl UTSW 11 116223807 missense probably damaging 1.00
R7278:Evpl UTSW 11 116223113 missense probably damaging 1.00
R7288:Evpl UTSW 11 116223949 missense probably benign
R7441:Evpl UTSW 11 116222956 nonsense probably null
R7505:Evpl UTSW 11 116226987 critical splice donor site probably null
R7674:Evpl UTSW 11 116222568 missense probably benign 0.40
R7772:Evpl UTSW 11 116221435 missense probably benign 0.00
R7780:Evpl UTSW 11 116234174 missense not run
R7861:Evpl UTSW 11 116228069 missense probably damaging 1.00
R7944:Evpl UTSW 11 116228069 missense probably damaging 1.00
R8008:Evpl UTSW 11 116230472 missense not run
R8040:Evpl UTSW 11 116222932 missense not run
R8052:Evpl UTSW 11 116223163 missense not run
Predicted Primers PCR Primer
(F):5'- TCCTTGGCCTCATGAATACAAG -3'
(R):5'- CACCGTTCATTGTGTCTGAGAC -3'

Sequencing Primer
(F):5'- GGCCTCATGAATACAAGCAGCTG -3'
(R):5'- GACACAATCTCTGTTAGCTGCAAGG -3'
Posted On2019-09-13