Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Dip2c'

573769

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 9614377 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Threonine at position 942 (N942T)

Ref Sequence

ENSEMBL: ENSMUSP00000133806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

AlphaFold

E9PWR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000166299
AA Change: N943T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: N943T

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169960
AA Change: N913T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: N913T

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174552
AA Change: N942T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: N942T

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R8354:Dip2c	UTSW	13	9621882	missense	probably benign	0.05
R8685:Dip2c	UTSW	13	9637125	missense	probably benign	0.01
R8779:Dip2c	UTSW	13	9610809	missense	probably damaging	0.98
R8786:Dip2c	UTSW	13	9615794	missense	probably damaging	0.99
R8815:Dip2c	UTSW	13	9623798	nonsense	probably null
R8833:Dip2c	UTSW	13	9575483	critical splice donor site	probably null
R8868:Dip2c	UTSW	13	9575467	missense	possibly damaging	0.73
R8873:Dip2c	UTSW	13	9575146	missense	probably benign	0.03
R8887:Dip2c	UTSW	13	9623953	splice site	probably benign
R8923:Dip2c	UTSW	13	9623865	missense	probably damaging	1.00
R9112:Dip2c	UTSW	13	9610730	missense	probably damaging	1.00
R9424:Dip2c	UTSW	13	9659395	missense	probably damaging	1.00
R9474:Dip2c	UTSW	13	9494927	missense	unknown
R9527:Dip2c	UTSW	13	9494839	missense	unknown
R9593:Dip2c	UTSW	13	9654647	missense	possibly damaging	0.89
R9615:Dip2c	UTSW	13	9575155	missense	probably benign	0.03
R9801:Dip2c	UTSW	13	9576900	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCATTTTGGCCATCACAAGCTC -3'
(R):5'- GACTCAGTTAAGACTCAGGACAG -3'

Sequencing Primer
(F):5'- ATTTTGGCCATCACAAGCTCATCAG -3'
(R):5'- GTTAAGACTCAGGACAGTCACTCTG -3'

Posted On

2019-09-13