Incidental Mutation 'R7395:Dip2c'
ID573769
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.516) question?
Stock #R7395 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 9614377 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 942 (N942T)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably damaging
Transcript: ENSMUST00000166299
AA Change: N943T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: N943T

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169960
AA Change: N913T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: N913T

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174552
AA Change: N942T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: N942T

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCATTTTGGCCATCACAAGCTC -3'
(R):5'- GACTCAGTTAAGACTCAGGACAG -3'

Sequencing Primer
(F):5'- ATTTTGGCCATCACAAGCTCATCAG -3'
(R):5'- GTTAAGACTCAGGACAGTCACTCTG -3'
Posted On2019-09-13