Incidental Mutation 'R7395:Atp6v1c1'
ID573774
Institutional Source Beutler Lab
Gene Symbol Atp6v1c1
Ensembl Gene ENSMUSG00000022295
Gene NameATPase, H+ transporting, lysosomal V1 subunit C1
Synonyms1700025B18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7395 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location38661933-38692446 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to C at 38691705 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 383 (*383Q)
Ref Sequence ENSEMBL: ENSMUSP00000022904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022904] [ENSMUST00000226533]
Predicted Effect probably null
Transcript: ENSMUST00000022904
AA Change: *383Q
SMART Domains Protein: ENSMUSP00000022904
Gene: ENSMUSG00000022295
AA Change: *383Q

DomainStartEndE-ValueType
Pfam:V-ATPase_C 4 370 1.2e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226533
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene is one of two genes that encode the V1 domain C subunit proteins and is found ubiquitously. This C subunit is analogous but not homologous to gamma subunit of F-ATPases. Previously, this gene was designated ATP6D. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
4930433I11Rik A T 7: 40,989,678 T13S probably damaging Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
B3glct A G 5: 149,725,604 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dcun1d2 G A 8: 13,278,675 R75* probably null Het
Defb19 A T 2: 152,580,023 probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Pdzph1 T A 17: 58,879,159 K1212N possibly damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tcstv1 A T 13: 119,894,130 probably null Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Tph1 C T 7: 46,657,203 probably null Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Ulk4 T A 9: 121,255,112 Q129L probably benign Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Atp6v1c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Atp6v1c1 APN 15 38686856 missense probably damaging 0.99
IGL01371:Atp6v1c1 APN 15 38682960 missense probably benign
IGL02987:Atp6v1c1 APN 15 38690562 missense possibly damaging 0.70
P0029:Atp6v1c1 UTSW 15 38686902 unclassified probably benign
R0550:Atp6v1c1 UTSW 15 38682929 splice site probably benign
R0669:Atp6v1c1 UTSW 15 38677528 missense probably benign 0.00
R2033:Atp6v1c1 UTSW 15 38673966 critical splice donor site probably null
R3021:Atp6v1c1 UTSW 15 38689216 missense possibly damaging 0.75
R4475:Atp6v1c1 UTSW 15 38677573 missense probably benign 0.03
R4612:Atp6v1c1 UTSW 15 38677612 missense probably damaging 1.00
R4798:Atp6v1c1 UTSW 15 38689176 missense probably damaging 1.00
R5095:Atp6v1c1 UTSW 15 38679413 critical splice donor site probably null
R5600:Atp6v1c1 UTSW 15 38686863 missense probably benign 0.17
R6177:Atp6v1c1 UTSW 15 38673928 nonsense probably null
R6434:Atp6v1c1 UTSW 15 38677546 missense probably damaging 0.99
R6916:Atp6v1c1 UTSW 15 38677581 missense probably benign 0.00
R6973:Atp6v1c1 UTSW 15 38690550 missense probably damaging 1.00
R7607:Atp6v1c1 UTSW 15 38683011 critical splice donor site probably null
R7712:Atp6v1c1 UTSW 15 38686805 missense probably benign 0.00
R8830:Atp6v1c1 UTSW 15 38677545 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGCATGACTTCAGCCAGACC -3'
(R):5'- TATGCATACCATGATATCAAGGAGG -3'

Sequencing Primer
(F):5'- GACCAGGTATCCGTAAAAGACCTTG -3'
(R):5'- TCAGTACACATTTACAGACCTGATC -3'
Posted On2019-09-13