Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Olfr136'

573778

Institutional Source

Beutler Lab

Gene Symbol

Olfr136

Ensembl Gene

ENSMUSG00000096840

Gene Name

olfactory receptor 136

Synonyms

GA_x6K02T2PSCP-2779375-2780313, MOR256-7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.154) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38329831-38336643 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 38335864 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 236 (K236*)

Ref Sequence

ENSEMBL: ENSMUSP00000146828 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077203] [ENSMUST00000208525] [ENSMUST00000208539] [ENSMUST00000214035] [ENSMUST00000216963]

AlphaFold

Q8VG72

Predicted Effect

probably null
Transcript: ENSMUST00000077203
AA Change: K236*

SMART Domains

Protein: ENSMUSP00000076443
Gene: ENSMUSG00000096840
AA Change: K236*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.6e-48	PFAM
Pfam:7tm_1	41	290	7.1e-25	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000208525
AA Change: K236*

Predicted Effect

probably null
Transcript: ENSMUST00000208539
AA Change: K236*

Predicted Effect

probably null
Transcript: ENSMUST00000214035
AA Change: K236*

Predicted Effect

probably null
Transcript: ENSMUST00000216963
AA Change: K236*

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Olfr136

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01712:Olfr136	APN	17	38335957	missense	probably benign	0.00
IGL01787:Olfr136	APN	17	38335579	missense	probably damaging	0.98
IGL02480:Olfr136	APN	17	38335423	missense	probably benign	0.32
IGL02603:Olfr136	APN	17	38335513	missense	probably damaging	1.00
IGL03122:Olfr136	APN	17	38335301	missense	probably benign	0.01
BB009:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
BB019:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
R0295:Olfr136	UTSW	17	38335291	missense	probably damaging	1.00
R0684:Olfr136	UTSW	17	38335844	missense	probably benign	0.11
R1874:Olfr136	UTSW	17	38335969	missense	probably damaging	1.00
R3436:Olfr136	UTSW	17	38335432	missense	probably damaging	1.00
R3437:Olfr136	UTSW	17	38335432	missense	probably damaging	1.00
R4714:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R4715:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R4716:Olfr136	UTSW	17	38335840	missense	possibly damaging	0.65
R4878:Olfr136	UTSW	17	38335627	missense	probably benign
R5296:Olfr136	UTSW	17	38335456	nonsense	probably null
R5370:Olfr136	UTSW	17	38335444	nonsense	probably null
R5413:Olfr136	UTSW	17	38335624	missense	probably benign	0.03
R5988:Olfr136	UTSW	17	38336020	missense	probably damaging	1.00
R6156:Olfr136	UTSW	17	38335173	missense	probably damaging	0.99
R6550:Olfr136	UTSW	17	38336005	missense	possibly damaging	0.65
R7417:Olfr136	UTSW	17	38335292	missense	probably damaging	1.00
R7746:Olfr136	UTSW	17	38335394	missense	probably benign	0.16
R7747:Olfr136	UTSW	17	38335394	missense	probably benign	0.16
R7821:Olfr136	UTSW	17	38335964	missense	probably benign	0.13
R7932:Olfr136	UTSW	17	38335255	missense	probably benign	0.01
R8409:Olfr136	UTSW	17	38335306	missense	probably benign	0.09
R8911:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8912:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8913:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8914:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R8968:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9006:Olfr136	UTSW	17	38335832	missense	possibly damaging	0.84
R9044:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9110:Olfr136	UTSW	17	38335543	missense	probably damaging	1.00
R9155:Olfr136	UTSW	17	38335333	missense	probably damaging	0.99
R9279:Olfr136	UTSW	17	38335523	missense	probably damaging	0.99
R9289:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9295:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9317:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9318:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9348:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9409:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9410:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9411:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9412:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9413:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9512:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9522:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
R9524:Olfr136	UTSW	17	38335649	nonsense	probably null
R9547:Olfr136	UTSW	17	38335450	missense	possibly damaging	0.80
R9580:Olfr136	UTSW	17	38335429	missense	possibly damaging	0.94
V5088:Olfr136	UTSW	17	38335159	start codon destroyed	probably null	0.99
Z1176:Olfr136	UTSW	17	38335352	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTGTGTGGCATACATAAACTGG -3'
(R):5'- TAAGGCACCCTTTACATCCTTG -3'

Sequencing Primer
(F):5'- GGATCATTTATTGTGTGAAATCCCAG -3'
(R):5'- CATCCTTGTTTCTTAGGGTATAGATG -3'

Posted On

2019-09-13