Incidental Mutation 'R7395:Pdzph1'
ID573780
Institutional Source Beutler Lab
Gene Symbol Pdzph1
Ensembl Gene ENSMUSG00000024227
Gene NamePDZ and pleckstrin homology domains 1
Synonyms2610034M16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7395 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location58878808-58991375 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58879159 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1212 (K1212N)
Ref Sequence ENSEMBL: ENSMUSP00000025064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025064] [ENSMUST00000177360]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025064
AA Change: K1212N

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025064
Gene: ENSMUSG00000024227
AA Change: K1212N

DomainStartEndE-ValueType
Blast:PDZ 780 844 6e-20 BLAST
PDZ 915 984 3.31e-15 SMART
PH 993 1096 9.4e-19 SMART
PH 1120 1218 2.83e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177360
AA Change: K172N

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135180
Gene: ENSMUSG00000024227
AA Change: K172N

DomainStartEndE-ValueType
SCOP:d1faoa_ 1 54 1e-4 SMART
Blast:PH 1 56 4e-33 BLAST
PH 80 178 2.83e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 99% (92/93)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
4930433I11Rik A T 7: 40,989,678 T13S probably damaging Het
Abca13 A G 11: 9,291,658 I1174V probably benign Het
Acoxl G A 2: 127,884,416 V237M probably damaging Het
Adam33 A C 2: 131,061,169 W52G probably benign Het
Adgrv1 T C 13: 81,559,348 H1313R probably damaging Het
Ap3d1 T C 10: 80,730,882 T89A probably benign Het
Armc8 T C 9: 99,533,132 E165G probably damaging Het
Atp6v1c1 T C 15: 38,691,705 *383Q probably null Het
Atp8b4 A T 2: 126,375,694 L634Q possibly damaging Het
B3glct A G 5: 149,725,604 probably null Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Bicd2 A G 13: 49,378,230 D316G possibly damaging Het
Bop1 A T 15: 76,453,841 S610T probably damaging Het
Car11 T A 7: 45,701,321 Y80* probably null Het
Ccdc96 T C 5: 36,485,265 I205T probably benign Het
Ces2a A G 8: 104,739,641 E390G probably benign Het
Cfap54 C A 10: 92,884,703 V2630L unknown Het
Chek2 G T 5: 110,872,108 probably null Het
Cntn3 C T 6: 102,337,394 probably null Het
Cpne3 A T 4: 19,528,239 D339E probably damaging Het
Crocc2 C T 1: 93,216,107 Q1403* probably null Het
Csnka2ip G A 16: 64,479,440 T187I Het
Ctu1 A G 7: 43,676,595 H226R possibly damaging Het
Cubn G T 2: 13,287,064 Q3317K probably damaging Het
Cyp17a1 A G 19: 46,670,695 L169P probably benign Het
Dcc T A 18: 71,374,569 K911* probably null Het
Dcun1d2 G A 8: 13,278,675 R75* probably null Het
Defb19 A T 2: 152,580,023 probably null Het
Dffb A T 4: 153,969,113 S257R probably damaging Het
Dip2c A C 13: 9,614,377 N942T probably damaging Het
Dnah3 T A 7: 119,966,251 I169F Het
Dnah3 T C 7: 120,060,960 M830V probably benign Het
Dnajc5g G A 5: 31,111,665 S130N possibly damaging Het
Dscaml1 C A 9: 45,702,405 Q939K possibly damaging Het
Evpl G C 11: 116,227,079 N761K possibly damaging Het
Fbxw8 A T 5: 118,068,215 I556N probably damaging Het
Fry G T 5: 150,380,883 M579I possibly damaging Het
Ggt7 A T 2: 155,495,880 M488K probably benign Het
Gm6588 A T 5: 112,450,169 E194V possibly damaging Het
Gnpnat1 T A 14: 45,381,581 H107L probably benign Het
Golga2 C A 2: 32,305,587 P798Q possibly damaging Het
Gpr35 G A 1: 92,983,207 A214T probably damaging Het
Greb1 A T 12: 16,709,430 probably null Het
Hdac10 G A 15: 89,128,284 T32I probably benign Het
Hkdc1 G A 10: 62,385,699 T860I probably damaging Het
Icam5 C A 9: 21,035,442 P422Q possibly damaging Het
Ispd A T 12: 36,501,995 I283F possibly damaging Het
Ist1 A C 8: 109,677,527 S238A probably benign Het
Lrig2 T C 3: 104,497,520 N91D probably benign Het
Mapt A C 11: 104,328,123 D352A probably damaging Het
Micall2 G A 5: 139,716,369 P373L possibly damaging Het
Mocs1 A G 17: 49,454,557 S560G possibly damaging Het
Mpo A G 11: 87,801,124 D461G probably damaging Het
Myo1a G T 10: 127,710,440 V271L probably damaging Het
Ncoa1 G A 12: 4,295,188 P720S not run Het
Ncr1 T A 7: 4,338,151 I47N probably damaging Het
Ndufb6 G A 4: 40,277,730 R66C probably damaging Het
Obox5 A T 7: 15,758,743 S208C probably damaging Het
Olfr136 A T 17: 38,335,864 K236* probably null Het
Olfr1494 T C 19: 13,749,138 S11P probably damaging Het
Olfr39 T A 9: 20,286,530 M285K probably damaging Het
Olfr501-ps1 T A 7: 108,508,404 F116Y unknown Het
Padi4 A C 4: 140,761,672 V152G probably damaging Het
Pdzd7 A T 19: 45,037,011 D348E probably damaging Het
Piezo2 C T 18: 63,027,563 G2341R probably damaging Het
Plb1 A G 5: 32,353,684 K1298E probably benign Het
Prr14l A G 5: 32,828,638 L1171P probably benign Het
Rab11fip5 T C 6: 85,341,868 T680A probably benign Het
Rev1 A T 1: 38,088,065 N371K possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,926 probably benign Het
Ryr2 A G 13: 11,785,111 C917R probably damaging Het
Sall1 A T 8: 89,030,921 S852T possibly damaging Het
Serpine2 A G 1: 79,801,555 F296L probably damaging Het
Slc12a6 A T 2: 112,352,542 N754I probably damaging Het
Slc39a6 A T 18: 24,585,275 L575Q probably damaging Het
Smarcc2 T A 10: 128,485,606 L890Q probably damaging Het
Smg5 T A 3: 88,361,071 V1006D probably damaging Het
Ssh2 T C 11: 77,393,073 V51A probably damaging Het
St14 T C 9: 31,096,899 K547E probably benign Het
Stag1 T G 9: 100,796,728 V234G probably damaging Het
Stag3 A T 5: 138,281,945 Q24L probably benign Het
Stra6 T C 9: 58,141,097 Y158H probably damaging Het
Tcstv1 A T 13: 119,894,130 probably null Het
Tmem196 G A 12: 120,011,267 C62Y probably damaging Het
Tmem265 T A 7: 127,564,867 F84L Het
Tph1 C T 7: 46,657,203 probably null Het
Ttn A G 2: 76,946,490 I1522T unknown Het
Ulk4 T A 9: 121,255,112 Q129L probably benign Het
Usp17la T A 7: 104,861,585 S466T probably benign Het
Vmn2r31 A T 7: 7,384,745 V609E probably damaging Het
Vmn2r52 C T 7: 10,170,817 C365Y probably benign Het
Zbtb4 A T 11: 69,776,111 T81S possibly damaging Het
Zfp605 A T 5: 110,112,019 probably benign Het
Other mutations in Pdzph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Pdzph1 APN 17 58974796 missense possibly damaging 0.46
IGL00644:Pdzph1 APN 17 58888110 missense probably benign
IGL01413:Pdzph1 APN 17 58879152 missense possibly damaging 0.82
IGL01530:Pdzph1 APN 17 58922715 missense probably damaging 1.00
IGL02089:Pdzph1 APN 17 58967339 missense possibly damaging 0.92
IGL02201:Pdzph1 APN 17 58967511 splice site probably benign
IGL02548:Pdzph1 APN 17 58973391 missense probably benign 0.10
IGL02618:Pdzph1 APN 17 58879073 utr 3 prime probably benign
IGL02660:Pdzph1 APN 17 58880647 missense probably damaging 0.97
IGL02749:Pdzph1 APN 17 58932483 missense possibly damaging 0.95
IGL02876:Pdzph1 APN 17 58974069 missense probably benign
IGL03304:Pdzph1 APN 17 58880646 missense probably damaging 1.00
IGL03336:Pdzph1 APN 17 58974234 missense probably benign 0.00
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0008:Pdzph1 UTSW 17 58922761 splice site probably benign
R0498:Pdzph1 UTSW 17 58973830 missense probably benign 0.00
R0553:Pdzph1 UTSW 17 58922727 missense probably damaging 1.00
R0594:Pdzph1 UTSW 17 58954479 missense possibly damaging 0.76
R1306:Pdzph1 UTSW 17 58932432 missense possibly damaging 0.90
R1370:Pdzph1 UTSW 17 58974087 missense possibly damaging 0.73
R1382:Pdzph1 UTSW 17 58974747 missense probably benign 0.10
R1463:Pdzph1 UTSW 17 58932445 missense probably damaging 1.00
R1766:Pdzph1 UTSW 17 58973752 missense probably benign 0.16
R1773:Pdzph1 UTSW 17 58974813 missense probably damaging 0.98
R1862:Pdzph1 UTSW 17 58922583 missense probably damaging 1.00
R2070:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2071:Pdzph1 UTSW 17 58974097 missense probably benign 0.04
R2229:Pdzph1 UTSW 17 58932412 splice site probably benign
R2264:Pdzph1 UTSW 17 58888167 critical splice acceptor site probably null
R2334:Pdzph1 UTSW 17 58922649 missense probably damaging 1.00
R3750:Pdzph1 UTSW 17 58973336 nonsense probably null
R4700:Pdzph1 UTSW 17 58974546 missense probably damaging 0.98
R4847:Pdzph1 UTSW 17 58973530 missense possibly damaging 0.95
R4868:Pdzph1 UTSW 17 58974756 missense probably benign 0.00
R5130:Pdzph1 UTSW 17 58922609 missense probably damaging 1.00
R5329:Pdzph1 UTSW 17 58974880 missense probably damaging 1.00
R5574:Pdzph1 UTSW 17 58973947 missense probably benign 0.00
R5770:Pdzph1 UTSW 17 58879151 missense probably damaging 1.00
R5795:Pdzph1 UTSW 17 58885867 missense possibly damaging 0.47
R5842:Pdzph1 UTSW 17 58974412 missense possibly damaging 0.64
R5851:Pdzph1 UTSW 17 58973746 missense probably benign 0.02
R6158:Pdzph1 UTSW 17 58973627 missense probably damaging 0.96
R6813:Pdzph1 UTSW 17 58974436 missense probably benign 0.08
R7022:Pdzph1 UTSW 17 58974126 missense probably benign 0.02
R7525:Pdzph1 UTSW 17 58967341 missense possibly damaging 0.73
R7944:Pdzph1 UTSW 17 58932460 missense probably damaging 1.00
R7945:Pdzph1 UTSW 17 58932460 missense probably damaging 1.00
R7992:Pdzph1 UTSW 17 58879110 missense possibly damaging 0.71
R8016:Pdzph1 UTSW 17 58932481 missense probably damaging 0.98
R8116:Pdzph1 UTSW 17 58975143 missense probably benign 0.01
R8273:Pdzph1 UTSW 17 58973014 missense probably benign 0.00
R8523:Pdzph1 UTSW 17 58884013 missense probably damaging 1.00
R8819:Pdzph1 UTSW 17 58880720 nonsense probably null
R8820:Pdzph1 UTSW 17 58880720 nonsense probably null
R8839:Pdzph1 UTSW 17 58950242 missense probably benign 0.02
R8871:Pdzph1 UTSW 17 58888038 missense probably damaging 1.00
X0028:Pdzph1 UTSW 17 58879121 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCAGGACAGCAGAAAG -3'
(R):5'- TATGAACATCAACTCTCCTACATGC -3'

Sequencing Primer
(F):5'- GAAATGCTATGCTTCTTTCCTCAAG -3'
(R):5'- ACTTTCATTACTGAGCCATCTTGG -3'
Posted On2019-09-13