Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Dcc'

573783

Institutional Source

Beutler Lab

Gene Symbol

Dcc

Ensembl Gene

ENSMUSG00000060534

Gene Name

deleted in colorectal carcinoma

Synonyms

C030036D22Rik, Igdcc1

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71258738-72351069 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 71374569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 911 (K911*)

Ref Sequence

ENSEMBL: ENSMUSP00000110593 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073379] [ENSMUST00000114943]

AlphaFold

P70211

Predicted Effect

probably null
Transcript: ENSMUST00000073379
AA Change: K891*

SMART Domains

Protein: ENSMUSP00000073094
Gene: ENSMUSG00000060534
AA Change: K891*

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
IG	46	137	9.12e-7	SMART
IGc2	152	219	1.75e-17	SMART
IGc2	252	317	4.12e-14	SMART
IGc2	343	407	8e-12	SMART
IG_like	424	520	1.06e2	SMART
FN3	429	511	6.69e-12	SMART
FN3	528	607	6.53e-15	SMART
FN3	622	705	2.09e-13	SMART
FN3	726	805	8.43e-9	SMART
FN3	824	909	2.48e-6	SMART
FN3	925	1011	1.35e-7	SMART
transmembrane domain	1079	1101	N/A	INTRINSIC
Pfam:Neogenin_C	1126	1425	5.5e-129	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000114943
AA Change: K911*

SMART Domains

Protein: ENSMUSP00000110593
Gene: ENSMUSG00000060534
AA Change: K911*

Domain	Start	End	E-Value	Type
transmembrane domain	5	27	N/A	INTRINSIC
IG	46	137	9.12e-7	SMART
IGc2	152	219	1.75e-17	SMART
IGc2	252	317	4.12e-14	SMART
IGc2	343	407	8e-12	SMART
IG_like	424	520	1.06e2	SMART
FN3	429	511	6.69e-12	SMART
FN3	528	607	6.53e-15	SMART
FN3	622	705	2.09e-13	SMART
FN3	726	805	8.43e-9	SMART
FN3	844	929	2.48e-6	SMART
FN3	945	1031	1.35e-7	SMART
transmembrane domain	1099	1121	N/A	INTRINSIC
Pfam:Neogenin_C	1148	1445	3.4e-113	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a netrin 1 receptor. The transmembrane protein is a member of the immunoglobulin superfamily of cell adhesion molecules, and mediates axon guidance of neuronal growth cones towards sources of netrin 1 ligand. The cytoplasmic tail interacts with the tyrosine kinases Src and focal adhesion kinase (FAK, also known as PTK2) to mediate axon attraction. The protein partially localizes to lipid rafts, and induces apoptosis in the absence of ligand. The protein functions as a tumor suppressor, and is frequently mutated or downregulated in colorectal cancer and esophageal carcinoma. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous animals show defects in axonal projections and hypothalamic development affecting both visual and neruoendocrine systems. Incidence of tumors increases in mutations preventing netrin-1 binding. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Dcc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00569:Dcc	APN	18	71384225	critical splice acceptor site	probably null
IGL00781:Dcc	APN	18	71809195	missense	probably benign	0.25
IGL00818:Dcc	APN	18	71955012	missense	probably benign
IGL00895:Dcc	APN	18	71810800	missense	probably damaging	0.98
IGL00969:Dcc	APN	18	71456883	missense	probably benign	0.25
IGL01019:Dcc	APN	18	71809090	missense	probably benign	0.00
IGL01132:Dcc	APN	18	71682174	nonsense	probably null
IGL01349:Dcc	APN	18	71370737	missense	probably damaging	1.00
IGL01355:Dcc	APN	18	71809114	missense	probably benign	0.00
IGL01374:Dcc	APN	18	71374553	missense	probably damaging	1.00
IGL01947:Dcc	APN	18	71826209	missense	probably benign
IGL02470:Dcc	APN	18	71955082	splice site	probably benign
IGL02508:Dcc	APN	18	71370702	missense	probably benign	0.00
IGL02999:Dcc	APN	18	71378678	missense	possibly damaging	0.68
IGL03034:Dcc	APN	18	71575143	nonsense	probably null
IGL03118:Dcc	APN	18	71420273	missense	probably benign	0.00
IGL03133:Dcc	APN	18	71262955	splice site	probably benign
IGL03357:Dcc	APN	18	71327554	missense	probably damaging	1.00
Hyperrev	UTSW	18	71259015	missense	probably damaging	1.00
LCD18:Dcc	UTSW	18	72297447	intron	probably benign
P0031:Dcc	UTSW	18	71384228	splice site	probably benign
PIT4142001:Dcc	UTSW	18	71384226	splice site	probably null
R0076:Dcc	UTSW	18	71321046	nonsense	probably null
R0355:Dcc	UTSW	18	71575208	missense	possibly damaging	0.75
R0370:Dcc	UTSW	18	71587985	missense	possibly damaging	0.92
R0383:Dcc	UTSW	18	71420263	missense	probably damaging	0.99
R0541:Dcc	UTSW	18	71259015	missense	probably damaging	1.00
R0690:Dcc	UTSW	18	71809204	splice site	probably benign
R0762:Dcc	UTSW	18	71342705	splice site	probably benign
R0765:Dcc	UTSW	18	71362990	missense	probably damaging	1.00
R0846:Dcc	UTSW	18	71826212	missense	probably benign	0.06
R1230:Dcc	UTSW	18	71682313	missense	probably damaging	1.00
R1662:Dcc	UTSW	18	71420338	missense	probably benign	0.00
R1663:Dcc	UTSW	18	71826052	missense	probably damaging	1.00
R1697:Dcc	UTSW	18	71370737	missense	probably damaging	1.00
R1770:Dcc	UTSW	18	71446399	missense	probably benign	0.01
R1781:Dcc	UTSW	18	71378717	missense	probably benign	0.41
R1797:Dcc	UTSW	18	71367161	missense	probably damaging	1.00
R2101:Dcc	UTSW	18	71810870	missense	possibly damaging	0.62
R2190:Dcc	UTSW	18	71547420	missense	possibly damaging	0.89
R2248:Dcc	UTSW	18	71826168	missense	probably benign	0.00
R2262:Dcc	UTSW	18	71374551	missense	probably damaging	1.00
R2442:Dcc	UTSW	18	71456883	missense	probably damaging	0.98
R3844:Dcc	UTSW	18	71826186	missense	probably benign	0.01
R4037:Dcc	UTSW	18	72350397	missense	possibly damaging	0.57
R4085:Dcc	UTSW	18	71826169	missense	probably benign	0.00
R4344:Dcc	UTSW	18	71374490	missense	probably damaging	0.99
R4499:Dcc	UTSW	18	71547317	missense	probably benign	0.07
R4611:Dcc	UTSW	18	71548998	splice site	probably null
R4811:Dcc	UTSW	18	71299483	missense	probably benign	0.31
R4937:Dcc	UTSW	18	71542249	nonsense	probably null
R5125:Dcc	UTSW	18	71456877	missense	probably benign	0.02
R5292:Dcc	UTSW	18	71306088	missense	probably damaging	1.00
R5297:Dcc	UTSW	18	71378738	missense	probably benign	0.00
R5317:Dcc	UTSW	18	71384155	missense	possibly damaging	0.78
R5691:Dcc	UTSW	18	71575083	missense	probably damaging	1.00
R5693:Dcc	UTSW	18	71575082	missense	probably damaging	1.00
R6091:Dcc	UTSW	18	71809114	missense	probably benign	0.00
R6291:Dcc	UTSW	18	71682167	missense	probably benign	0.06
R6307:Dcc	UTSW	18	71810755	missense	probably benign	0.15
R6343:Dcc	UTSW	18	71336035	missense	probably damaging	1.00
R6508:Dcc	UTSW	18	71306073	missense	probably damaging	1.00
R6701:Dcc	UTSW	18	71809120	missense	probably benign	0.02
R6810:Dcc	UTSW	18	71370693	missense	probably damaging	0.99
R7078:Dcc	UTSW	18	71547398	missense	probably benign	0.05
R7172:Dcc	UTSW	18	71378684	missense	probably benign	0.04
R7345:Dcc	UTSW	18	71378824	missense	probably benign	0.00
R7365:Dcc	UTSW	18	71826123	missense	probably damaging	0.98
R7455:Dcc	UTSW	18	71420323	missense	probably benign	0.00
R7461:Dcc	UTSW	18	71306034	missense	probably damaging	1.00
R7485:Dcc	UTSW	18	71420246	missense	probably benign	0.00
R7732:Dcc	UTSW	18	71446435	missense	probably benign	0.24
R7886:Dcc	UTSW	18	71954868	nonsense	probably null
R8097:Dcc	UTSW	18	71679502	missense	probably damaging	1.00
R8137:Dcc	UTSW	18	71378712	missense	probably benign	0.00
R8188:Dcc	UTSW	18	71810857	missense	probably benign
R8236:Dcc	UTSW	18	71955018	missense	probably benign
R8802:Dcc	UTSW	18	71826054	missense	probably damaging	1.00
R8869:Dcc	UTSW	18	71378684	missense	probably benign	0.04
R9221:Dcc	UTSW	18	71420362	missense	possibly damaging	0.66
R9282:Dcc	UTSW	18	71682178	missense	possibly damaging	0.85
R9366:Dcc	UTSW	18	71575210	missense	probably damaging	1.00
R9566:Dcc	UTSW	18	71810795	missense	possibly damaging	0.92
R9607:Dcc	UTSW	18	71588001	missense	probably damaging	1.00
W0251:Dcc	UTSW	18	71826083	missense	probably damaging	1.00
X0020:Dcc	UTSW	18	71321100	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- ATGCCTCGACTTCCACAGAG -3'
(R):5'- GTAAAGTCTCAGAAGCACAGCC -3'

Sequencing Primer
(F):5'- TCGACTTCCACAGAGTTAGTG -3'
(R):5'- AGCCCACCAGTATATATTGGCTG -3'

Posted On

2019-09-13