Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Cyp17a1'

573786

Institutional Source

Beutler Lab

Gene Symbol

Cyp17a1

Ensembl Gene

ENSMUSG00000003555

Gene Name

cytochrome P450, family 17, subfamily a, polypeptide 1

Synonyms

steroid 17-alpha hydroxylase, p450c17, Cyp17

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.172) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46667165-46672974 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 46670695 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 169 (L169P)

Ref Sequence

ENSEMBL: ENSMUSP00000026012 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026012]

AlphaFold

P27786

Predicted Effect

probably benign
Transcript: ENSMUST00000026012
AA Change: L169P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026012
Gene: ENSMUSG00000003555
AA Change: L169P

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:p450	28	492	2.6e-140	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum. It has both 17alpha-hydroxylase and 17,20-lyase activities and is a key enzyme in the steroidogenic pathway that produces progestins, mineralocorticoids, glucocorticoids, androgens, and estrogens. Mutations in this gene are associated with isolated steroid-17 alpha-hydroxylase deficiency, 17-alpha-hydroxylase/17,20-lyase deficiency, pseudohermaphroditism, and adrenal hyperplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null embryos display early embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cubn	G	T	2: 13,287,064	Q3317K	probably damaging	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Cyp17a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01524:Cyp17a1	APN	19	46671056	missense	probably benign	0.00
IGL01839:Cyp17a1	APN	19	46670671	missense	possibly damaging	0.89
IGL01901:Cyp17a1	APN	19	46671092	missense	possibly damaging	0.64
IGL02033:Cyp17a1	APN	19	46672607	nonsense	probably null
IGL02349:Cyp17a1	APN	19	46667497	missense	probably damaging	1.00
IGL02663:Cyp17a1	APN	19	46672566	missense	probably damaging	1.00
IGL02883:Cyp17a1	APN	19	46669351	missense	probably benign	0.00
IGL03092:Cyp17a1	APN	19	46672611	missense	possibly damaging	0.79
IGL03239:Cyp17a1	APN	19	46667357	missense	probably damaging	1.00
IGL03336:Cyp17a1	APN	19	46671035	missense	probably benign	0.00
R3773:Cyp17a1	UTSW	19	46669723	missense	probably damaging	0.97
R4445:Cyp17a1	UTSW	19	46668023	missense	probably damaging	1.00
R4446:Cyp17a1	UTSW	19	46668023	missense	probably damaging	1.00
R4572:Cyp17a1	UTSW	19	46670551	missense	probably damaging	1.00
R5544:Cyp17a1	UTSW	19	46672654	missense	probably damaging	1.00
R5730:Cyp17a1	UTSW	19	46672656	missense	possibly damaging	0.49
R6163:Cyp17a1	UTSW	19	46669322	missense	possibly damaging	0.69
R6271:Cyp17a1	UTSW	19	46672720	missense	probably benign	0.17
R6728:Cyp17a1	UTSW	19	46669234	missense	probably benign
R6729:Cyp17a1	UTSW	19	46670581	missense	probably benign
R7025:Cyp17a1	UTSW	19	46670980	missense	probably damaging	0.98
R8056:Cyp17a1	UTSW	19	46670591	missense	possibly damaging	0.95
R8308:Cyp17a1	UTSW	19	46668077	missense	probably benign	0.09
R8735:Cyp17a1	UTSW	19	46671094	critical splice acceptor site	probably null
R8737:Cyp17a1	UTSW	19	46669727	missense	probably benign	0.09
R9091:Cyp17a1	UTSW	19	46667591	missense	probably benign	0.00
R9270:Cyp17a1	UTSW	19	46667591	missense	probably benign	0.00
R9364:Cyp17a1	UTSW	19	46668726	missense	probably damaging	1.00
R9554:Cyp17a1	UTSW	19	46668726	missense	probably damaging	1.00
X0020:Cyp17a1	UTSW	19	46671020	missense	possibly damaging	0.88
Z1177:Cyp17a1	UTSW	19	46672659	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTGAAAGTACTGGGGACACTG -3'
(R):5'- AGCCATTTCTTAGCGGCTGC -3'

Sequencing Primer
(F):5'- ACTGTCGCAGTGGGATCTC -3'
(R):5'- CCTATCCCTGGATAAGACCT -3'

Posted On

2019-09-13