Incidental Mutation 'R7396:Acacb'
ID573809
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Nameacetyl-Coenzyme A carboxylase beta
SynonymsAcc2, Accb
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7396 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location114146535-114250761 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114213661 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1153 (D1153G)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031583
AA Change: D1153G

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: D1153G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102582
AA Change: D1153G

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: D1153G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Meta Mutation Damage Score 0.5461 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
Abcb5 A G 12: 118,867,874 Y1248H probably damaging Het
Acsm3 T A 7: 119,773,829 L185H probably damaging Het
Actr1a G A 19: 46,379,629 T293I probably benign Het
Adig T C 2: 158,505,916 L50P unknown Het
Ankrd28 A G 14: 31,702,202 S994P probably benign Het
Ankrd35 T A 3: 96,683,497 D366E probably damaging Het
Aqr A T 2: 114,119,946 Y927* probably null Het
Asxl2 T A 12: 3,442,529 I38N probably damaging Het
Atp9b T C 18: 80,736,842 I1092V Het
B4galnt1 A G 10: 127,171,616 E462G possibly damaging Het
BC048671 T A 6: 90,303,291 V63E probably damaging Het
BC067074 T A 13: 113,318,990 S523R Het
Bod1l A G 5: 41,831,546 V406A probably damaging Het
Btn1a1 T G 13: 23,461,498 I234L probably benign Het
Camk2b A C 11: 5,978,432 S436A probably benign Het
Cc2d1a A T 8: 84,143,745 probably null Het
Ces1b G T 8: 93,063,129 N390K probably benign Het
Chpf T C 1: 75,475,283 Q671R probably benign Het
Dbr1 C A 9: 99,583,390 N340K probably damaging Het
Dram1 T A 10: 88,340,645 T73S probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efemp1 A T 11: 28,867,501 R39S possibly damaging Het
Eif2b5 T G 16: 20,506,137 I515S possibly damaging Het
Eif2d A T 1: 131,166,374 N434I probably benign Het
Ercc6 C T 14: 32,569,805 T1042I probably benign Het
Etl4 C T 2: 20,798,638 P1057L possibly damaging Het
Fbxw16 T A 9: 109,449,023 N29I probably damaging Het
Fbxw18 T C 9: 109,688,886 D344G probably benign Het
Fgf15 G T 7: 144,899,805 V172L probably benign Het
Fmod T C 1: 134,040,240 V6A probably benign Het
Furin C A 7: 80,398,114 R86L probably benign Het
Gabrr1 T C 4: 33,160,207 V297A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Helb T C 10: 120,089,571 D967G probably benign Het
Hmcn1 T C 1: 150,563,631 T5601A possibly damaging Het
Hsbp1l1 G T 18: 80,233,419 P70Q not run Het
Hsd17b1 T C 11: 101,079,207 V155A probably damaging Het
Ireb2 T A 9: 54,882,333 M97K possibly damaging Het
Kcnj6 C A 16: 94,762,447 L397F probably benign Het
Lcorl A T 5: 45,857,459 probably null Het
Lgi2 A T 5: 52,538,411 I402N probably damaging Het
Lrat T A 3: 82,903,283 R144* probably null Het
Mfhas1 G T 8: 35,590,199 L609F probably damaging Het
Mink1 T A 11: 70,605,168 I398K possibly damaging Het
Muc5ac A T 7: 141,808,415 D1821V unknown Het
Myh2 T C 11: 67,194,728 probably null Het
Ncor1 T C 11: 62,343,218 E386G probably damaging Het
Ndufaf3 C T 9: 108,566,603 V76M probably damaging Het
Neurod4 T C 10: 130,271,022 T128A probably damaging Het
Ogfod1 T A 8: 94,038,987 D59E probably benign Het
Olfr1369-ps1 T C 13: 21,116,307 V205A probably benign Het
Olfr531 C T 7: 140,400,563 R161H probably benign Het
Olfr667 C T 7: 104,916,351 S315N probably benign Het
Pcdh15 T A 10: 74,630,690 V1513D probably benign Het
Pclo C A 5: 14,539,888 T734K unknown Het
Phc2 A G 4: 128,748,161 R759G probably benign Het
Plch1 A T 3: 63,698,954 N1176K probably benign Het
Plec T A 15: 76,174,889 Y3616F probably damaging Het
Ptpn11 G T 5: 121,144,644 T426N probably benign Het
Rictor A G 15: 6,786,981 T1245A not run Het
Rilp T C 11: 75,510,886 V164A probably damaging Het
Rnf39 A T 17: 36,947,079 T168S probably damaging Het
Rptor C G 11: 119,872,355 Q922E probably benign Het
Sall1 A T 8: 89,032,768 L236Q probably damaging Het
Skint7 A G 4: 111,988,127 T379A probably benign Het
Spata22 C A 11: 73,345,876 T336N probably damaging Het
Spata31 T C 13: 64,920,733 S232P probably benign Het
Spink5 T A 18: 43,977,655 C98S possibly damaging Het
Stard6 T C 18: 70,500,435 V171A possibly damaging Het
Tex9 A T 9: 72,480,790 probably null Het
Traf7 T C 17: 24,509,545 D621G probably damaging Het
Trak1 C T 9: 121,448,907 T353M possibly damaging Het
Trim68 A T 7: 102,678,362 Y461* probably null Het
Usp1 A G 4: 98,926,451 probably benign Het
Vmn2r42 T A 7: 8,192,642 I502F probably benign Het
Wbp4 C A 14: 79,476,821 G84C probably damaging Het
Zfp787 A G 7: 6,132,107 *382Q probably null Het
Zfp831 G T 2: 174,645,209 C559F possibly damaging Het
Zgpat G C 2: 181,366,089 A140P probably benign Het
Zscan4e T A 7: 11,307,075 Y290F probably benign Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114200289 missense probably damaging 1.00
IGL01291:Acacb APN 5 114225870 missense probably benign 0.03
IGL01301:Acacb APN 5 114246498 missense probably benign
IGL01633:Acacb APN 5 114218858 splice site probably benign
IGL01736:Acacb APN 5 114188442 missense possibly damaging 0.96
IGL01782:Acacb APN 5 114200520 missense probably damaging 1.00
IGL01924:Acacb APN 5 114223986 splice site probably benign
IGL01933:Acacb APN 5 114184190 splice site probably benign
IGL02028:Acacb APN 5 114166015 missense probably damaging 1.00
IGL02045:Acacb APN 5 114240660 missense possibly damaging 0.95
IGL02346:Acacb APN 5 114238699 missense probably damaging 1.00
IGL02421:Acacb APN 5 114223878 missense probably benign 0.00
IGL02445:Acacb APN 5 114245137 missense probably damaging 1.00
IGL02491:Acacb APN 5 114192105 missense probably damaging 1.00
IGL02598:Acacb APN 5 114246037 missense probably damaging 1.00
IGL02700:Acacb APN 5 114218881 missense probably damaging 1.00
IGL02730:Acacb APN 5 114166149 splice site probably benign
IGL03110:Acacb APN 5 114195234 missense probably damaging 0.96
IGL03125:Acacb APN 5 114204805 missense possibly damaging 0.49
IGL03263:Acacb APN 5 114213693 missense probably damaging 1.00
IGL03324:Acacb APN 5 114225854 nonsense probably null
ANU05:Acacb UTSW 5 114225870 missense probably benign 0.03
ANU18:Acacb UTSW 5 114246498 missense probably benign
BB001:Acacb UTSW 5 114245220 missense possibly damaging 0.63
BB011:Acacb UTSW 5 114245220 missense possibly damaging 0.63
I0000:Acacb UTSW 5 114238655 missense probably damaging 0.99
R0001:Acacb UTSW 5 114204833 splice site probably benign
R0219:Acacb UTSW 5 114232944 missense possibly damaging 0.79
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0234:Acacb UTSW 5 114209817 missense probably damaging 0.99
R0278:Acacb UTSW 5 114233259 nonsense probably null
R0607:Acacb UTSW 5 114200301 missense probably damaging 1.00
R0964:Acacb UTSW 5 114229752 missense possibly damaging 0.64
R1116:Acacb UTSW 5 114210956 missense probably damaging 1.00
R1196:Acacb UTSW 5 114245092 missense probably benign 0.00
R1204:Acacb UTSW 5 114190153 missense probably damaging 1.00
R1387:Acacb UTSW 5 114200512 missense probably benign
R1415:Acacb UTSW 5 114165921 missense probably benign
R1475:Acacb UTSW 5 114195252 missense possibly damaging 0.87
R1497:Acacb UTSW 5 114196807 missense probably damaging 1.00
R1520:Acacb UTSW 5 114201940 missense possibly damaging 0.67
R1591:Acacb UTSW 5 114203423 missense possibly damaging 0.87
R1644:Acacb UTSW 5 114195285 missense probably damaging 1.00
R1732:Acacb UTSW 5 114190087 missense possibly damaging 0.63
R1783:Acacb UTSW 5 114209767 frame shift probably null
R1784:Acacb UTSW 5 114209767 frame shift probably null
R1834:Acacb UTSW 5 114235475 missense probably damaging 1.00
R1858:Acacb UTSW 5 114196709 missense probably benign 0.13
R1886:Acacb UTSW 5 114218959 missense probably damaging 1.00
R1901:Acacb UTSW 5 114165734 nonsense probably null
R1902:Acacb UTSW 5 114165734 nonsense probably null
R1903:Acacb UTSW 5 114165734 nonsense probably null
R1924:Acacb UTSW 5 114230720 missense possibly damaging 0.67
R1934:Acacb UTSW 5 114198282 missense probably benign 0.27
R2051:Acacb UTSW 5 114245890 missense probably damaging 1.00
R2132:Acacb UTSW 5 114209767 frame shift probably null
R2133:Acacb UTSW 5 114209767 frame shift probably null
R2260:Acacb UTSW 5 114216917 missense probably damaging 0.99
R2967:Acacb UTSW 5 114166070 missense possibly damaging 0.81
R3421:Acacb UTSW 5 114212636 splice site probably null
R3729:Acacb UTSW 5 114207348 missense probably damaging 0.99
R4206:Acacb UTSW 5 114213651 missense probably benign
R4245:Acacb UTSW 5 114230784 missense probably damaging 0.97
R4386:Acacb UTSW 5 114241921 critical splice acceptor site probably null
R4439:Acacb UTSW 5 114246496 missense possibly damaging 0.50
R4577:Acacb UTSW 5 114226831 missense probably damaging 1.00
R4658:Acacb UTSW 5 114200564 missense probably damaging 0.96
R4688:Acacb UTSW 5 114204763 missense probably benign 0.01
R4720:Acacb UTSW 5 114229914 missense possibly damaging 0.73
R4898:Acacb UTSW 5 114232938 missense probably benign 0.04
R5044:Acacb UTSW 5 114166027 missense probably benign 0.03
R5070:Acacb UTSW 5 114246028 missense possibly damaging 0.46
R5294:Acacb UTSW 5 114241952 missense probably damaging 1.00
R5350:Acacb UTSW 5 114244551 missense probably damaging 1.00
R5401:Acacb UTSW 5 114209853 missense possibly damaging 0.80
R5531:Acacb UTSW 5 114204706 missense possibly damaging 0.92
R5542:Acacb UTSW 5 114195737 missense probably damaging 1.00
R5751:Acacb UTSW 5 114230832 missense possibly damaging 0.79
R5821:Acacb UTSW 5 114184106 missense possibly damaging 0.69
R5893:Acacb UTSW 5 114229851 missense probably benign 0.01
R5911:Acacb UTSW 5 114232890 missense probably damaging 0.97
R5944:Acacb UTSW 5 114245980 missense probably damaging 1.00
R5973:Acacb UTSW 5 114226867 missense probably damaging 1.00
R6027:Acacb UTSW 5 114165600 missense probably benign 0.43
R6103:Acacb UTSW 5 114245881 missense probably damaging 1.00
R6139:Acacb UTSW 5 114212652 missense probably damaging 1.00
R6292:Acacb UTSW 5 114200251 missense probably damaging 1.00
R6368:Acacb UTSW 5 114216823 missense probably damaging 0.98
R6429:Acacb UTSW 5 114228591 missense probably damaging 1.00
R6942:Acacb UTSW 5 114191963 critical splice donor site probably null
R7138:Acacb UTSW 5 114207326 missense probably benign 0.12
R7241:Acacb UTSW 5 114245100 missense possibly damaging 0.94
R7254:Acacb UTSW 5 114209751 critical splice acceptor site probably null
R7439:Acacb UTSW 5 114195642 missense possibly damaging 0.84
R7484:Acacb UTSW 5 114218862 missense probably damaging 1.00
R7585:Acacb UTSW 5 114246012 missense probably damaging 0.99
R7712:Acacb UTSW 5 114165738 missense probably benign 0.13
R7868:Acacb UTSW 5 114248227 missense probably benign 0.22
R7873:Acacb UTSW 5 114223278 missense possibly damaging 0.88
R7924:Acacb UTSW 5 114245220 missense possibly damaging 0.63
R7940:Acacb UTSW 5 114166047 missense possibly damaging 0.77
R7951:Acacb UTSW 5 114188340 missense probably damaging 1.00
R7960:Acacb UTSW 5 114230861 missense probably benign 0.00
R7972:Acacb UTSW 5 114226857 nonsense probably null
R8007:Acacb UTSW 5 114218874 missense probably damaging 0.97
R8022:Acacb UTSW 5 114223854 missense probably benign
R8030:Acacb UTSW 5 114233167 missense probably damaging 1.00
R8241:Acacb UTSW 5 114195236 missense possibly damaging 0.49
R8264:Acacb UTSW 5 114207366 missense probably benign 0.00
R8292:Acacb UTSW 5 114200494 critical splice acceptor site probably null
V1662:Acacb UTSW 5 114238708 missense probably damaging 1.00
Z1176:Acacb UTSW 5 114248948 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTTGCCACAAGTTATGGGC -3'
(R):5'- CTGGACCTTTCTAGAAAATAGTTGGG -3'

Sequencing Primer
(F):5'- CCACAAGTTATGGGCAGAGC -3'
(R):5'- TTCGTGACAGAGAACTTGCC -3'
Posted On2019-09-13