Incidental Mutation 'R7396:Acsm3'
ID573817
Institutional Source Beutler Lab
Gene Symbol Acsm3
Ensembl Gene ENSMUSG00000030935
Gene Nameacyl-CoA synthetase medium-chain family member 3
SynonymsSah, Sa
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7396 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119760923-119787513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119773829 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 185 (L185H)
Ref Sequence ENSEMBL: ENSMUSP00000102139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529]
Predicted Effect probably damaging
Transcript: ENSMUST00000063770
AA Change: L185H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935
AA Change: L185H

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106526
AA Change: L185H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935
AA Change: L185H

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106527
AA Change: L185H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935
AA Change: L185H

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106528
AA Change: L185H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935
AA Change: L185H

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106529
AA Change: L185H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935
AA Change: L185H

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with normal kidney function and morphology and blood pressure similar to wild-type on either a regular or high salt diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
Abcb5 A G 12: 118,867,874 Y1248H probably damaging Het
Acacb A G 5: 114,213,661 D1153G possibly damaging Het
Actr1a G A 19: 46,379,629 T293I probably benign Het
Adig T C 2: 158,505,916 L50P unknown Het
Ankrd28 A G 14: 31,702,202 S994P probably benign Het
Ankrd35 T A 3: 96,683,497 D366E probably damaging Het
Aqr A T 2: 114,119,946 Y927* probably null Het
Asxl2 T A 12: 3,442,529 I38N probably damaging Het
Atp9b T C 18: 80,736,842 I1092V Het
B4galnt1 A G 10: 127,171,616 E462G possibly damaging Het
BC048671 T A 6: 90,303,291 V63E probably damaging Het
BC067074 T A 13: 113,318,990 S523R Het
Bod1l A G 5: 41,831,546 V406A probably damaging Het
Btn1a1 T G 13: 23,461,498 I234L probably benign Het
Camk2b A C 11: 5,978,432 S436A probably benign Het
Ces1b G T 8: 93,063,129 N390K probably benign Het
Chpf T C 1: 75,475,283 Q671R probably benign Het
Dbr1 C A 9: 99,583,390 N340K probably damaging Het
Dram1 T A 10: 88,340,645 T73S probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efemp1 A T 11: 28,867,501 R39S possibly damaging Het
Eif2b5 T G 16: 20,506,137 I515S possibly damaging Het
Eif2d A T 1: 131,166,374 N434I probably benign Het
Ercc6 C T 14: 32,569,805 T1042I probably benign Het
Etl4 C T 2: 20,798,638 P1057L possibly damaging Het
Fbxw16 T A 9: 109,449,023 N29I probably damaging Het
Fbxw18 T C 9: 109,688,886 D344G probably benign Het
Fgf15 G T 7: 144,899,805 V172L probably benign Het
Fmod T C 1: 134,040,240 V6A probably benign Het
Furin C A 7: 80,398,114 R86L probably benign Het
Gabrr1 T C 4: 33,160,207 V297A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Helb T C 10: 120,089,571 D967G probably benign Het
Hmcn1 T C 1: 150,563,631 T5601A possibly damaging Het
Hsbp1l1 G T 18: 80,233,419 P70Q not run Het
Hsd17b1 T C 11: 101,079,207 V155A probably damaging Het
Ireb2 T A 9: 54,882,333 M97K possibly damaging Het
Kcnj6 C A 16: 94,762,447 L397F probably benign Het
Lgi2 A T 5: 52,538,411 I402N probably damaging Het
Lrat T A 3: 82,903,283 R144* probably null Het
Mfhas1 G T 8: 35,590,199 L609F probably damaging Het
Mink1 T A 11: 70,605,168 I398K possibly damaging Het
Muc5ac A T 7: 141,808,415 D1821V unknown Het
Myh2 T C 11: 67,194,728 probably null Het
Ncor1 T C 11: 62,343,218 E386G probably damaging Het
Ndufaf3 C T 9: 108,566,603 V76M probably damaging Het
Neurod4 T C 10: 130,271,022 T128A probably damaging Het
Ogfod1 T A 8: 94,038,987 D59E probably benign Het
Olfr1369-ps1 T C 13: 21,116,307 V205A probably benign Het
Olfr531 C T 7: 140,400,563 R161H probably benign Het
Olfr667 C T 7: 104,916,351 S315N probably benign Het
Pcdh15 T A 10: 74,630,690 V1513D probably benign Het
Pclo C A 5: 14,539,888 T734K unknown Het
Phc2 A G 4: 128,748,161 R759G probably benign Het
Plch1 A T 3: 63,698,954 N1176K probably benign Het
Plec T A 15: 76,174,889 Y3616F probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,659,014 probably benign Het
Ptpn11 G T 5: 121,144,644 T426N probably benign Het
Rictor A G 15: 6,786,981 T1245A not run Het
Rilp T C 11: 75,510,886 V164A probably damaging Het
Rnf39 A T 17: 36,947,079 T168S probably damaging Het
Rptor C G 11: 119,872,355 Q922E probably benign Het
Sall1 A T 8: 89,032,768 L236Q probably damaging Het
Skint7 A G 4: 111,988,127 T379A probably benign Het
Spata22 C A 11: 73,345,876 T336N probably damaging Het
Spata31 T C 13: 64,920,733 S232P probably benign Het
Spink5 T A 18: 43,977,655 C98S possibly damaging Het
Stard6 T C 18: 70,500,435 V171A possibly damaging Het
Traf7 T C 17: 24,509,545 D621G probably damaging Het
Trak1 C T 9: 121,448,907 T353M possibly damaging Het
Trim68 A T 7: 102,678,362 Y461* probably null Het
Usp1 A G 4: 98,926,451 probably benign Het
Wbp4 C A 14: 79,476,821 G84C probably damaging Het
Zfp787 A G 7: 6,132,107 *382Q probably null Het
Zfp831 G T 2: 174,645,209 C559F possibly damaging Het
Zgpat G C 2: 181,366,089 A140P probably benign Het
Zscan4e T A 7: 11,307,075 Y290F probably benign Het
Other mutations in Acsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Acsm3 APN 7 119784344 missense probably damaging 1.00
IGL01434:Acsm3 APN 7 119781074 unclassified probably benign
IGL01446:Acsm3 APN 7 119778454 missense probably damaging 1.00
IGL01800:Acsm3 APN 7 119774643 missense possibly damaging 0.68
IGL01882:Acsm3 APN 7 119774635 missense probably damaging 0.99
IGL01954:Acsm3 APN 7 119775083 splice site probably benign
PIT4677001:Acsm3 UTSW 7 119775117 missense probably damaging 1.00
PIT4696001:Acsm3 UTSW 7 119784986 splice site probably null
R0422:Acsm3 UTSW 7 119773740 nonsense probably null
R0423:Acsm3 UTSW 7 119777159 missense probably damaging 1.00
R0729:Acsm3 UTSW 7 119783984 utr 3 prime probably benign
R0731:Acsm3 UTSW 7 119768024 nonsense probably null
R0732:Acsm3 UTSW 7 119773834 missense probably benign 0.40
R0744:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R0836:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R1926:Acsm3 UTSW 7 119777136 missense probably damaging 1.00
R2104:Acsm3 UTSW 7 119784304 missense probably benign
R2429:Acsm3 UTSW 7 119768000 missense probably benign
R3940:Acsm3 UTSW 7 119773886 missense probably benign 0.03
R4386:Acsm3 UTSW 7 119773871 missense probably damaging 1.00
R5437:Acsm3 UTSW 7 119778497 intron probably benign
R5890:Acsm3 UTSW 7 119775234 missense probably benign
R6278:Acsm3 UTSW 7 119773849 missense probably damaging 1.00
R6350:Acsm3 UTSW 7 119768033 missense probably benign
R6497:Acsm3 UTSW 7 119780749 critical splice acceptor site probably null
R6582:Acsm3 UTSW 7 119779673 missense probably benign
R6670:Acsm3 UTSW 7 119780755 unclassified probably null
R6939:Acsm3 UTSW 7 119778455 missense probably damaging 1.00
R7037:Acsm3 UTSW 7 119768043 missense probably damaging 1.00
R7087:Acsm3 UTSW 7 119774647 missense probably damaging 1.00
R7301:Acsm3 UTSW 7 119777085 missense possibly damaging 0.92
R7381:Acsm3 UTSW 7 119780826 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTATCCTATCATAGAAGTTACCCTTGC -3'
(R):5'- GCACTGCCAACTGTTAGTTCTG -3'

Sequencing Primer
(F):5'- GCTGACCCAGAAAGACATC -3'
(R):5'- GCCAACTGTTAGTTCTGTAACAATC -3'
Posted On2019-09-13