Incidental Mutation 'R7396:Fgf15'
ID573821
Institutional Source Beutler Lab
Gene Symbol Fgf15
Ensembl Gene ENSMUSG00000031073
Gene Namefibroblast growth factor 15
SynonymsFGF19
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7396 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location144896531-144900953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 144899805 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 172 (V172L)
Ref Sequence ENSEMBL: ENSMUSP00000033389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033389] [ENSMUST00000207229]
Predicted Effect probably benign
Transcript: ENSMUST00000033389
AA Change: V172L

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033389
Gene: ENSMUSG00000031073
AA Change: V172L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FGF 49 177 1.93e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207229
AA Change: V137L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This growth factor is a high affinity, heparin dependent ligand for FGFR4. Expression of this gene was detected only in fetal but not adult brain tissue. Synergistic interaction of the chick homolog and Wnt-8c has been shown to be required for initiation of inner ear development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to a severe underrepresentation of homozygotes at weaning as well as highly penetrant ventricular septal defects and malalignment of the aorta and pulmonary trunk. No abnormalities in otic induction or otic vesicle formation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
Abcb5 A G 12: 118,867,874 Y1248H probably damaging Het
Acacb A G 5: 114,213,661 D1153G possibly damaging Het
Acsm3 T A 7: 119,773,829 L185H probably damaging Het
Actr1a G A 19: 46,379,629 T293I probably benign Het
Adig T C 2: 158,505,916 L50P unknown Het
Ankrd28 A G 14: 31,702,202 S994P probably benign Het
Ankrd35 T A 3: 96,683,497 D366E probably damaging Het
Aqr A T 2: 114,119,946 Y927* probably null Het
Asxl2 T A 12: 3,442,529 I38N probably damaging Het
Atp9b T C 18: 80,736,842 I1092V Het
B4galnt1 A G 10: 127,171,616 E462G possibly damaging Het
BC048671 T A 6: 90,303,291 V63E probably damaging Het
BC067074 T A 13: 113,318,990 S523R Het
Bod1l A G 5: 41,831,546 V406A probably damaging Het
Btn1a1 T G 13: 23,461,498 I234L probably benign Het
Camk2b A C 11: 5,978,432 S436A probably benign Het
Ces1b G T 8: 93,063,129 N390K probably benign Het
Chpf T C 1: 75,475,283 Q671R probably benign Het
Dbr1 C A 9: 99,583,390 N340K probably damaging Het
Dram1 T A 10: 88,340,645 T73S probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efemp1 A T 11: 28,867,501 R39S possibly damaging Het
Eif2b5 T G 16: 20,506,137 I515S possibly damaging Het
Eif2d A T 1: 131,166,374 N434I probably benign Het
Ercc6 C T 14: 32,569,805 T1042I probably benign Het
Etl4 C T 2: 20,798,638 P1057L possibly damaging Het
Fbxw16 T A 9: 109,449,023 N29I probably damaging Het
Fbxw18 T C 9: 109,688,886 D344G probably benign Het
Fmod T C 1: 134,040,240 V6A probably benign Het
Furin C A 7: 80,398,114 R86L probably benign Het
Gabrr1 T C 4: 33,160,207 V297A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Helb T C 10: 120,089,571 D967G probably benign Het
Hmcn1 T C 1: 150,563,631 T5601A possibly damaging Het
Hsbp1l1 G T 18: 80,233,419 P70Q not run Het
Hsd17b1 T C 11: 101,079,207 V155A probably damaging Het
Ireb2 T A 9: 54,882,333 M97K possibly damaging Het
Kcnj6 C A 16: 94,762,447 L397F probably benign Het
Lgi2 A T 5: 52,538,411 I402N probably damaging Het
Lrat T A 3: 82,903,283 R144* probably null Het
Mfhas1 G T 8: 35,590,199 L609F probably damaging Het
Mink1 T A 11: 70,605,168 I398K possibly damaging Het
Muc5ac A T 7: 141,808,415 D1821V unknown Het
Myh2 T C 11: 67,194,728 probably null Het
Ncor1 T C 11: 62,343,218 E386G probably damaging Het
Ndufaf3 C T 9: 108,566,603 V76M probably damaging Het
Neurod4 T C 10: 130,271,022 T128A probably damaging Het
Ogfod1 T A 8: 94,038,987 D59E probably benign Het
Olfr1369-ps1 T C 13: 21,116,307 V205A probably benign Het
Olfr531 C T 7: 140,400,563 R161H probably benign Het
Olfr667 C T 7: 104,916,351 S315N probably benign Het
Pcdh15 T A 10: 74,630,690 V1513D probably benign Het
Pclo C A 5: 14,539,888 T734K unknown Het
Phc2 A G 4: 128,748,161 R759G probably benign Het
Plch1 A T 3: 63,698,954 N1176K probably benign Het
Plec T A 15: 76,174,889 Y3616F probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,659,014 probably benign Het
Ptpn11 G T 5: 121,144,644 T426N probably benign Het
Rictor A G 15: 6,786,981 T1245A not run Het
Rilp T C 11: 75,510,886 V164A probably damaging Het
Rnf39 A T 17: 36,947,079 T168S probably damaging Het
Rptor C G 11: 119,872,355 Q922E probably benign Het
Sall1 A T 8: 89,032,768 L236Q probably damaging Het
Skint7 A G 4: 111,988,127 T379A probably benign Het
Spata22 C A 11: 73,345,876 T336N probably damaging Het
Spata31 T C 13: 64,920,733 S232P probably benign Het
Spink5 T A 18: 43,977,655 C98S possibly damaging Het
Stard6 T C 18: 70,500,435 V171A possibly damaging Het
Traf7 T C 17: 24,509,545 D621G probably damaging Het
Trak1 C T 9: 121,448,907 T353M possibly damaging Het
Trim68 A T 7: 102,678,362 Y461* probably null Het
Usp1 A G 4: 98,926,451 probably benign Het
Wbp4 C A 14: 79,476,821 G84C probably damaging Het
Zfp787 A G 7: 6,132,107 *382Q probably null Het
Zfp831 G T 2: 174,645,209 C559F possibly damaging Het
Zgpat G C 2: 181,366,089 A140P probably benign Het
Zscan4e T A 7: 11,307,075 Y290F probably benign Het
Other mutations in Fgf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Fgf15 APN 7 144899892 missense probably damaging 1.00
IGL00764:Fgf15 APN 7 144896935 splice site probably null
R1690:Fgf15 UTSW 7 144899928 missense probably damaging 1.00
R2444:Fgf15 UTSW 7 144899692 missense probably benign 0.03
R5073:Fgf15 UTSW 7 144896839 missense possibly damaging 0.94
R6149:Fgf15 UTSW 7 144899769 nonsense probably null
R7287:Fgf15 UTSW 7 144896794 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CATGCACACAGCCTCTTGTC -3'
(R):5'- AATATGTACAGCTTCCTAAGGGG -3'

Sequencing Primer
(F):5'- GTCTCTTTCTCCAAAGATTCGCTAC -3'
(R):5'- TTCCTAAGGGGGAAGTTCACG -3'
Posted On2019-09-13