Incidental Mutation 'R7396:Dbr1'
ID573827
Institutional Source Beutler Lab
Gene Symbol Dbr1
Ensembl Gene ENSMUSG00000032469
Gene Namedebranching RNA lariats 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7396 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location99575799-99584501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 99583390 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 340 (N340K)
Ref Sequence ENSEMBL: ENSMUSP00000070991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066650] [ENSMUST00000139796] [ENSMUST00000148987]
Predicted Effect probably damaging
Transcript: ENSMUST00000066650
AA Change: N340K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070991
Gene: ENSMUSG00000032469
AA Change: N340K

DomainStartEndE-ValueType
Pfam:Metallophos 1 230 1.8e-11 PFAM
DBR1 235 380 8.27e-85 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136884
SMART Domains Protein: ENSMUSP00000114670
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
DBR1 20 128 4.22e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138002
SMART Domains Protein: ENSMUSP00000119924
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:Metallophos 2 144 5.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139796
SMART Domains Protein: ENSMUSP00000115203
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
Pfam:DBR1 52 82 1.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148987
SMART Domains Protein: ENSMUSP00000115074
Gene: ENSMUSG00000032469

DomainStartEndE-ValueType
DBR1 162 231 1.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156035
Meta Mutation Damage Score 0.6960 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA lariat debranching enzyme that hydrolyzes 2'-5' prime branched phosphodiester bonds. The encoded protein specifically targets the bonds at the branch point of excised lariat intron RNA, converting them to linear molecules that are then degraded. This protein may also be involved in retroviral replication. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit prenatal lethality. Mice heterozygous for this allele exhibit impaired class switch recombination in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
Abcb5 A G 12: 118,867,874 Y1248H probably damaging Het
Acacb A G 5: 114,213,661 D1153G possibly damaging Het
Acsm3 T A 7: 119,773,829 L185H probably damaging Het
Actr1a G A 19: 46,379,629 T293I probably benign Het
Adig T C 2: 158,505,916 L50P unknown Het
Ankrd28 A G 14: 31,702,202 S994P probably benign Het
Ankrd35 T A 3: 96,683,497 D366E probably damaging Het
Aqr A T 2: 114,119,946 Y927* probably null Het
Asxl2 T A 12: 3,442,529 I38N probably damaging Het
Atp9b T C 18: 80,736,842 I1092V Het
B4galnt1 A G 10: 127,171,616 E462G possibly damaging Het
BC048671 T A 6: 90,303,291 V63E probably damaging Het
BC067074 T A 13: 113,318,990 S523R Het
Bod1l A G 5: 41,831,546 V406A probably damaging Het
Btn1a1 T G 13: 23,461,498 I234L probably benign Het
Camk2b A C 11: 5,978,432 S436A probably benign Het
Cc2d1a A T 8: 84,143,745 probably null Het
Ces1b G T 8: 93,063,129 N390K probably benign Het
Chpf T C 1: 75,475,283 Q671R probably benign Het
Dram1 T A 10: 88,340,645 T73S probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efemp1 A T 11: 28,867,501 R39S possibly damaging Het
Eif2b5 T G 16: 20,506,137 I515S possibly damaging Het
Eif2d A T 1: 131,166,374 N434I probably benign Het
Ercc6 C T 14: 32,569,805 T1042I probably benign Het
Etl4 C T 2: 20,798,638 P1057L possibly damaging Het
Fbxw16 T A 9: 109,449,023 N29I probably damaging Het
Fbxw18 T C 9: 109,688,886 D344G probably benign Het
Fgf15 G T 7: 144,899,805 V172L probably benign Het
Fmod T C 1: 134,040,240 V6A probably benign Het
Furin C A 7: 80,398,114 R86L probably benign Het
Gabrr1 T C 4: 33,160,207 V297A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Helb T C 10: 120,089,571 D967G probably benign Het
Hmcn1 T C 1: 150,563,631 T5601A possibly damaging Het
Hsbp1l1 G T 18: 80,233,419 P70Q not run Het
Hsd17b1 T C 11: 101,079,207 V155A probably damaging Het
Ireb2 T A 9: 54,882,333 M97K possibly damaging Het
Kcnj6 C A 16: 94,762,447 L397F probably benign Het
Lcorl A T 5: 45,857,459 probably null Het
Lgi2 A T 5: 52,538,411 I402N probably damaging Het
Lrat T A 3: 82,903,283 R144* probably null Het
Mfhas1 G T 8: 35,590,199 L609F probably damaging Het
Mink1 T A 11: 70,605,168 I398K possibly damaging Het
Muc5ac A T 7: 141,808,415 D1821V unknown Het
Myh2 T C 11: 67,194,728 probably null Het
Ncor1 T C 11: 62,343,218 E386G probably damaging Het
Ndufaf3 C T 9: 108,566,603 V76M probably damaging Het
Neurod4 T C 10: 130,271,022 T128A probably damaging Het
Ogfod1 T A 8: 94,038,987 D59E probably benign Het
Olfr1369-ps1 T C 13: 21,116,307 V205A probably benign Het
Olfr531 C T 7: 140,400,563 R161H probably benign Het
Olfr667 C T 7: 104,916,351 S315N probably benign Het
Pcdh15 T A 10: 74,630,690 V1513D probably benign Het
Pclo C A 5: 14,539,888 T734K unknown Het
Phc2 A G 4: 128,748,161 R759G probably benign Het
Plch1 A T 3: 63,698,954 N1176K probably benign Het
Plec T A 15: 76,174,889 Y3616F probably damaging Het
Ptpn11 G T 5: 121,144,644 T426N probably benign Het
Rictor A G 15: 6,786,981 T1245A not run Het
Rilp T C 11: 75,510,886 V164A probably damaging Het
Rnf39 A T 17: 36,947,079 T168S probably damaging Het
Rptor C G 11: 119,872,355 Q922E probably benign Het
Sall1 A T 8: 89,032,768 L236Q probably damaging Het
Skint7 A G 4: 111,988,127 T379A probably benign Het
Spata22 C A 11: 73,345,876 T336N probably damaging Het
Spata31 T C 13: 64,920,733 S232P probably benign Het
Spink5 T A 18: 43,977,655 C98S possibly damaging Het
Stard6 T C 18: 70,500,435 V171A possibly damaging Het
Tex9 A T 9: 72,480,790 probably null Het
Traf7 T C 17: 24,509,545 D621G probably damaging Het
Trak1 C T 9: 121,448,907 T353M possibly damaging Het
Trim68 A T 7: 102,678,362 Y461* probably null Het
Usp1 A G 4: 98,926,451 probably benign Het
Vmn2r42 T A 7: 8,192,642 I502F probably benign Het
Wbp4 C A 14: 79,476,821 G84C probably damaging Het
Zfp787 A G 7: 6,132,107 *382Q probably null Het
Zfp831 G T 2: 174,645,209 C559F possibly damaging Het
Zgpat G C 2: 181,366,089 A140P probably benign Het
Zscan4e T A 7: 11,307,075 Y290F probably benign Het
Other mutations in Dbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01642:Dbr1 APN 9 99575978 missense probably damaging 1.00
IGL01952:Dbr1 APN 9 99582412 missense possibly damaging 0.64
IGL01995:Dbr1 APN 9 99583899 missense probably benign 0.00
FR4340:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4342:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583674 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4449:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4548:Dbr1 UTSW 9 99583673 nonsense probably null
FR4589:Dbr1 UTSW 9 99583677 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583680 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583683 unclassified probably benign
FR4589:Dbr1 UTSW 9 99583696 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583686 unclassified probably benign
FR4737:Dbr1 UTSW 9 99583699 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583689 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583692 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583701 unclassified probably benign
FR4976:Dbr1 UTSW 9 99583702 unclassified probably benign
PIT4131001:Dbr1 UTSW 9 99584019 unclassified probably null
R0100:Dbr1 UTSW 9 99583669 missense probably benign 0.01
R1240:Dbr1 UTSW 9 99584020 missense probably benign 0.44
R1502:Dbr1 UTSW 9 99582387 missense probably damaging 1.00
R2265:Dbr1 UTSW 9 99579410 missense probably damaging 1.00
R2279:Dbr1 UTSW 9 99580147 missense probably benign 0.06
R5202:Dbr1 UTSW 9 99583891 missense probably benign 0.00
R7012:Dbr1 UTSW 9 99583321 nonsense probably null
R7025:Dbr1 UTSW 9 99575983 missense probably damaging 1.00
R7037:Dbr1 UTSW 9 99576568 splice site probably null
R7192:Dbr1 UTSW 9 99576702 critical splice donor site probably null
R7350:Dbr1 UTSW 9 99582549 missense
R7601:Dbr1 UTSW 9 99582602 nonsense probably null
R7659:Dbr1 UTSW 9 99576610 missense probably damaging 1.00
RF028:Dbr1 UTSW 9 99583697 nonsense probably null
RF033:Dbr1 UTSW 9 99583697 nonsense probably null
RF038:Dbr1 UTSW 9 99583697 unclassified probably benign
RF040:Dbr1 UTSW 9 99583697 nonsense probably null
RF043:Dbr1 UTSW 9 99583697 unclassified probably benign
RF045:Dbr1 UTSW 9 99583671 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ACTCCTTGTATCTGGAGTCCA -3'
(R):5'- GTCTGTGTTGTACTCACTCCGG -3'

Sequencing Primer
(F):5'- CCTTGTATCTGGAGTCCATACTTAGG -3'
(R):5'- GGTCCTCTTCAGACTCCTCAG -3'
Posted On2019-09-13