Mutagenetix > Incidental Mutations

Incidental Mutation 'R7396:Asxl2'

573846

Institutional Source

Beutler Lab

Gene Symbol

Asxl2

Ensembl Gene

ENSMUSG00000037486

Gene Name

additional sex combs like 2, transcriptional regulator

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.939) question?

Stock #

R7396 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3426857-3506852 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3442529 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 38 (I38N)

Ref Sequence

ENSEMBL: ENSMUSP00000106846 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092003] [ENSMUST00000111215] [ENSMUST00000144247] [ENSMUST00000153102]

Predicted Effect

probably damaging
Transcript: ENSMUST00000092003
AA Change: I38N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000089629
Gene: ENSMUSG00000037486
AA Change: I38N

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.2e-22	PFAM
low complexity region	95	122	N/A	INTRINSIC
low complexity region	126	154	N/A	INTRINSIC
low complexity region	162	185	N/A	INTRINSIC
Pfam:ASXH	204	336	1.2e-52	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111215
AA Change: I38N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106846
Gene: ENSMUSG00000037486
AA Change: I38N

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	3.6e-22	PFAM
low complexity region	95	122	N/A	INTRINSIC
low complexity region	126	154	N/A	INTRINSIC
low complexity region	162	185	N/A	INTRINSIC
Pfam:ASXH	204	336	4.2e-52	PFAM
low complexity region	614	637	N/A	INTRINSIC
low complexity region	640	658	N/A	INTRINSIC
low complexity region	849	870	N/A	INTRINSIC
low complexity region	1115	1124	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
Pfam:PHD_3	1305	1368	1.1e-29	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000133639
Gene: ENSMUSG00000037486
AA Change: I8N

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	1	54	1.2e-16	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000144247
AA Change: I38N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000116048
Gene: ENSMUSG00000037486
AA Change: I38N

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	5.2e-23	PFAM
low complexity region	95	122	N/A	INTRINSIC
low complexity region	126	154	N/A	INTRINSIC
low complexity region	162	185	N/A	INTRINSIC
low complexity region	221	244	N/A	INTRINSIC
Pfam:ASXH	252	384	7e-54	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000153102
AA Change: I38N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117384
Gene: ENSMUSG00000037486
AA Change: I38N

Domain	Start	End	E-Value	Type
Pfam:HARE-HTH	11	83	1.6e-23	PFAM
low complexity region	95	122	N/A	INTRINSIC
low complexity region	126	154	N/A	INTRINSIC
low complexity region	162	185	N/A	INTRINSIC
Pfam:ASXH	211	335	6.9e-38	PFAM
low complexity region	614	637	N/A	INTRINSIC
low complexity region	640	658	N/A	INTRINSIC
low complexity region	849	870	N/A	INTRINSIC
low complexity region	1115	1124	N/A	INTRINSIC
low complexity region	1236	1251	N/A	INTRINSIC
Pfam:PHD_3	1308	1368	7.6e-29	PFAM

Meta Mutation Damage Score

0.7187

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: This gene encodes a homolog of the Drosophila Asx gene, which interacts with genes involved in axial patterning. Mice with mutations in this gene display abnormal patterning of the axial skeleton, suggesting a similar function in mice as in Drosophila. This gene may also be involved in bone mineral density, specifically osteoclastogenesis. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a severe hypomorphic allele display prenatal and postnatal lethality, premature death, vertebral transformations and splitting, decreased body weight, enlarged hearts, and age-related cardiac interstitial fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
Abcb5	A	G	12: 118,867,874	Y1248H	probably damaging	Het
Acacb	A	G	5: 114,213,661	D1153G	possibly damaging	Het
Acsm3	T	A	7: 119,773,829	L185H	probably damaging	Het
Actr1a	G	A	19: 46,379,629	T293I	probably benign	Het
Adig	T	C	2: 158,505,916	L50P	unknown	Het
Ankrd28	A	G	14: 31,702,202	S994P	probably benign	Het
Ankrd35	T	A	3: 96,683,497	D366E	probably damaging	Het
Aqr	A	T	2: 114,119,946	Y927*	probably null	Het
Atp9b	T	C	18: 80,736,842	I1092V		Het
B4galnt1	A	G	10: 127,171,616	E462G	possibly damaging	Het
BC048671	T	A	6: 90,303,291	V63E	probably damaging	Het
BC067074	T	A	13: 113,318,990	S523R		Het
Bod1l	A	G	5: 41,831,546	V406A	probably damaging	Het
Btn1a1	T	G	13: 23,461,498	I234L	probably benign	Het
Camk2b	A	C	11: 5,978,432	S436A	probably benign	Het
Cc2d1a	A	T	8: 84,143,745		probably null	Het
Ces1b	G	T	8: 93,063,129	N390K	probably benign	Het
Chpf	T	C	1: 75,475,283	Q671R	probably benign	Het
Dbr1	C	A	9: 99,583,390	N340K	probably damaging	Het
Dram1	T	A	10: 88,340,645	T73S	probably benign	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Efemp1	A	T	11: 28,867,501	R39S	possibly damaging	Het
Eif2b5	T	G	16: 20,506,137	I515S	possibly damaging	Het
Eif2d	A	T	1: 131,166,374	N434I	probably benign	Het
Ercc6	C	T	14: 32,569,805	T1042I	probably benign	Het
Etl4	C	T	2: 20,798,638	P1057L	possibly damaging	Het
Fbxw16	T	A	9: 109,449,023	N29I	probably damaging	Het
Fbxw18	T	C	9: 109,688,886	D344G	probably benign	Het
Fgf15	G	T	7: 144,899,805	V172L	probably benign	Het
Fmod	T	C	1: 134,040,240	V6A	probably benign	Het
Furin	C	A	7: 80,398,114	R86L	probably benign	Het
Gabrr1	T	C	4: 33,160,207	V297A	probably damaging	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Helb	T	C	10: 120,089,571	D967G	probably benign	Het
Hmcn1	T	C	1: 150,563,631	T5601A	possibly damaging	Het
Hsbp1l1	G	T	18: 80,233,419	P70Q	not run	Het
Hsd17b1	T	C	11: 101,079,207	V155A	probably damaging	Het
Ireb2	T	A	9: 54,882,333	M97K	possibly damaging	Het
Kcnj6	C	A	16: 94,762,447	L397F	probably benign	Het
Lcorl	A	T	5: 45,857,459		probably null	Het
Lgi2	A	T	5: 52,538,411	I402N	probably damaging	Het
Lrat	T	A	3: 82,903,283	R144*	probably null	Het
Mfhas1	G	T	8: 35,590,199	L609F	probably damaging	Het
Mink1	T	A	11: 70,605,168	I398K	possibly damaging	Het
Muc5ac	A	T	7: 141,808,415	D1821V	unknown	Het
Myh2	T	C	11: 67,194,728		probably null	Het
Ncor1	T	C	11: 62,343,218	E386G	probably damaging	Het
Ndufaf3	C	T	9: 108,566,603	V76M	probably damaging	Het
Neurod4	T	C	10: 130,271,022	T128A	probably damaging	Het
Ogfod1	T	A	8: 94,038,987	D59E	probably benign	Het
Olfr1369-ps1	T	C	13: 21,116,307	V205A	probably benign	Het
Olfr531	C	T	7: 140,400,563	R161H	probably benign	Het
Olfr667	C	T	7: 104,916,351	S315N	probably benign	Het
Pcdh15	T	A	10: 74,630,690	V1513D	probably benign	Het
Pclo	C	A	5: 14,539,888	T734K	unknown	Het
Phc2	A	G	4: 128,748,161	R759G	probably benign	Het
Plch1	A	T	3: 63,698,954	N1176K	probably benign	Het
Plec	T	A	15: 76,174,889	Y3616F	probably damaging	Het
Ptpn11	G	T	5: 121,144,644	T426N	probably benign	Het
Rictor	A	G	15: 6,786,981	T1245A	not run	Het
Rilp	T	C	11: 75,510,886	V164A	probably damaging	Het
Rnf39	A	T	17: 36,947,079	T168S	probably damaging	Het
Rptor	C	G	11: 119,872,355	Q922E	probably benign	Het
Sall1	A	T	8: 89,032,768	L236Q	probably damaging	Het
Skint7	A	G	4: 111,988,127	T379A	probably benign	Het
Spata22	C	A	11: 73,345,876	T336N	probably damaging	Het
Spata31	T	C	13: 64,920,733	S232P	probably benign	Het
Spink5	T	A	18: 43,977,655	C98S	possibly damaging	Het
Stard6	T	C	18: 70,500,435	V171A	possibly damaging	Het
Tex9	A	T	9: 72,480,790		probably null	Het
Traf7	T	C	17: 24,509,545	D621G	probably damaging	Het
Trak1	C	T	9: 121,448,907	T353M	possibly damaging	Het
Trim68	A	T	7: 102,678,362	Y461*	probably null	Het
Usp1	A	G	4: 98,926,451		probably benign	Het
Vmn2r42	T	A	7: 8,192,642	I502F	probably benign	Het
Wbp4	C	A	14: 79,476,821	G84C	probably damaging	Het
Zfp787	A	G	7: 6,132,107	*382Q	probably null	Het
Zfp831	G	T	2: 174,645,209	C559F	possibly damaging	Het
Zgpat	G	C	2: 181,366,089	A140P	probably benign	Het
Zscan4e	T	A	7: 11,307,075	Y290F	probably benign	Het

Other mutations in Asxl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Asxl2	APN	12	3474560	missense	probably damaging	1.00
IGL01301:Asxl2	APN	12	3501425	missense	probably damaging	1.00
IGL01325:Asxl2	APN	12	3427172	missense	probably damaging	0.98
IGL01689:Asxl2	APN	12	3496425	missense	probably benign	0.28
IGL01871:Asxl2	APN	12	3502112	missense	probably benign	0.38
IGL02164:Asxl2	APN	12	3502079	missense	probably benign	0.00
IGL02609:Asxl2	APN	12	3500018	missense	probably damaging	1.00
IGL03191:Asxl2	APN	12	3500094	missense	probably damaging	1.00
Blinder	UTSW	12	3442529	missense	probably damaging	0.99
Fob	UTSW	12	3484531	missense	probably damaging	1.00
peaky	UTSW	12	3476040	missense	possibly damaging	0.91
ANU18:Asxl2	UTSW	12	3501425	missense	probably damaging	1.00
R0092:Asxl2	UTSW	12	3496313	missense	probably benign	0.00
R0118:Asxl2	UTSW	12	3496923	missense	probably damaging	1.00
R0277:Asxl2	UTSW	12	3442487	missense	probably damaging	1.00
R0323:Asxl2	UTSW	12	3442487	missense	probably damaging	1.00
R0584:Asxl2	UTSW	12	3496632	missense	probably damaging	0.96
R0885:Asxl2	UTSW	12	3501458	missense	probably damaging	1.00
R1344:Asxl2	UTSW	12	3493790	missense	probably damaging	1.00
R1456:Asxl2	UTSW	12	3501872	missense	possibly damaging	0.70
R1829:Asxl2	UTSW	12	3457125	missense	probably damaging	1.00
R1909:Asxl2	UTSW	12	3474577	missense	probably damaging	1.00
R1990:Asxl2	UTSW	12	3484558	nonsense	probably null
R2074:Asxl2	UTSW	12	3493779	missense	probably damaging	1.00
R2883:Asxl2	UTSW	12	3501830	missense	probably benign	0.03
R2912:Asxl2	UTSW	12	3474517	missense	probably benign	0.06
R4446:Asxl2	UTSW	12	3501774	missense	possibly damaging	0.54
R4662:Asxl2	UTSW	12	3427193	missense	probably damaging	0.99
R4726:Asxl2	UTSW	12	3501872	missense	possibly damaging	0.70
R5034:Asxl2	UTSW	12	3502193	missense	probably damaging	0.98
R5287:Asxl2	UTSW	12	3496893	missense	probably benign	0.02
R5377:Asxl2	UTSW	12	3474618	splice site	probably null
R5611:Asxl2	UTSW	12	3484598	missense	probably damaging	1.00
R5708:Asxl2	UTSW	12	3500603	missense	possibly damaging	0.82
R5945:Asxl2	UTSW	12	3500439	missense	possibly damaging	0.82
R6154:Asxl2	UTSW	12	3496593	missense	possibly damaging	0.60
R6288:Asxl2	UTSW	12	3476040	missense	possibly damaging	0.91
R6405:Asxl2	UTSW	12	3493758	missense	probably damaging	0.99
R6938:Asxl2	UTSW	12	3476149	missense	probably damaging	0.98
R7146:Asxl2	UTSW	12	3457066	missense	probably damaging	1.00
R7354:Asxl2	UTSW	12	3455637	intron	probably benign
R7438:Asxl2	UTSW	12	3427108	start gained	probably benign
R7980:Asxl2	UTSW	12	3496630	missense	probably damaging	0.99
R7991:Asxl2	UTSW	12	3484531	missense	probably damaging	1.00
R8063:Asxl2	UTSW	12	3500768	missense	probably benign	0.01
R8156:Asxl2	UTSW	12	3496760	missense	probably benign	0.09
R8396:Asxl2	UTSW	12	3502220	missense	probably benign
Z1177:Asxl2	UTSW	12	3474589	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- ATGCACAGTCACAGATAGGG -3'
(R):5'- GGCATAAAGATAATTCCAGACCTTCTG -3'

Sequencing Primer
(F):5'- ACTGTTTGTGGCTGAGGAAAAAGTC -3'
(R):5'- CCTTCTGAAGAATTAATGTGCATAGG -3'

Posted On

2019-09-13