Incidental Mutation 'R7396:Traf7'
ID573859
Institutional Source Beutler Lab
Gene Symbol Traf7
Ensembl Gene ENSMUSG00000052752
Gene NameTNF receptor-associated factor 7
SynonymsRFWD1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.652) question?
Stock #R7396 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24508562-24527938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24509545 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 621 (D621G)
Ref Sequence ENSEMBL: ENSMUSP00000135267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024958] [ENSMUST00000070777] [ENSMUST00000088464] [ENSMUST00000176086] [ENSMUST00000176178] [ENSMUST00000176237] [ENSMUST00000176324] [ENSMUST00000176353] [ENSMUST00000176652] [ENSMUST00000176668] [ENSMUST00000177154] [ENSMUST00000177193] [ENSMUST00000177401] [ENSMUST00000177405]
Predicted Effect probably benign
Transcript: ENSMUST00000024958
SMART Domains Protein: ENSMUSP00000024958
Gene: ENSMUSG00000033597

DomainStartEndE-ValueType
ANK 48 77 9.93e-5 SMART
ANK 81 110 1.9e-1 SMART
ANK 114 143 1.51e-4 SMART
ANK 147 176 1.15e0 SMART
ANK 188 217 2.6e-8 SMART
ANK 220 249 3.31e-1 SMART
SH3 284 346 3.62e-5 SMART
Pfam:Caskin1-CID 373 421 3e-26 PFAM
SAM 473 539 3.63e-15 SMART
SAM 542 609 5.41e-14 SMART
low complexity region 631 647 N/A INTRINSIC
low complexity region 667 679 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
low complexity region 841 863 N/A INTRINSIC
Pfam:Caskin-Pro-rich 878 966 3e-37 PFAM
low complexity region 1163 1168 N/A INTRINSIC
low complexity region 1190 1216 N/A INTRINSIC
low complexity region 1222 1232 N/A INTRINSIC
low complexity region 1269 1288 N/A INTRINSIC
low complexity region 1294 1312 N/A INTRINSIC
low complexity region 1315 1333 N/A INTRINSIC
low complexity region 1344 1359 N/A INTRINSIC
Pfam:Caskin-tail 1369 1431 7.2e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000070777
AA Change: D621G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000069334
Gene: ENSMUSG00000052752
AA Change: D621G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000088464
AA Change: D661G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000085812
Gene: ENSMUSG00000052752
AA Change: D661G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Pfam:zf-TRAF 221 277 3.4e-8 PFAM
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175698
Predicted Effect probably benign
Transcript: ENSMUST00000176086
SMART Domains Protein: ENSMUSP00000135845
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 103 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176178
SMART Domains Protein: ENSMUSP00000134808
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176237
SMART Domains Protein: ENSMUSP00000134946
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 91 124 4.73e-6 SMART
Pfam:zf-TRAF 182 238 8.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176324
Predicted Effect probably damaging
Transcript: ENSMUST00000176353
AA Change: D621G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135267
Gene: ENSMUSG00000052752
AA Change: D621G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
RING 92 125 4.73e-6 SMART
coiled coil region 264 332 N/A INTRINSIC
WD40 344 383 8.35e-11 SMART
WD40 387 424 8.42e-7 SMART
WD40 427 463 2.09e-2 SMART
WD40 468 504 1.92e0 SMART
WD40 507 544 5.15e-2 SMART
WD40 547 588 1.78e-5 SMART
WD40 591 628 1.63e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176652
AA Change: D661G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134759
Gene: ENSMUSG00000052752
AA Change: D661G

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
coiled coil region 304 372 N/A INTRINSIC
WD40 384 423 8.35e-11 SMART
WD40 427 464 8.42e-7 SMART
WD40 467 503 2.09e-2 SMART
WD40 508 544 1.92e0 SMART
WD40 547 584 5.15e-2 SMART
WD40 587 628 1.78e-5 SMART
WD40 631 668 1.63e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176668
SMART Domains Protein: ENSMUSP00000135586
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177154
SMART Domains Protein: ENSMUSP00000135874
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 91 105 N/A INTRINSIC
low complexity region 110 118 N/A INTRINSIC
RING 131 164 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177193
SMART Domains Protein: ENSMUSP00000135288
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 90 104 N/A INTRINSIC
low complexity region 109 117 N/A INTRINSIC
RING 130 163 4.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177401
Predicted Effect probably benign
Transcript: ENSMUST00000177405
SMART Domains Protein: ENSMUSP00000135127
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177502
SMART Domains Protein: ENSMUSP00000134970
Gene: ENSMUSG00000052752

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
RING 24 68 4.24e-2 SMART
Meta Mutation Damage Score 0.8940 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Tumor necrosis factor (TNF; see MIM 191160) receptor-associated factors, such as TRAF7, are signal transducers for members of the TNF receptor superfamily (see MIM 191190). TRAFs are composed of an N-terminal cysteine/histidine-rich region containing zinc RING and/or zinc finger motifs; a coiled-coil (leucine zipper) motif; and a homologous region that defines the TRAF family, the TRAF domain, which is involved in self-association and receptor binding.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
Abcb5 A G 12: 118,867,874 Y1248H probably damaging Het
Acacb A G 5: 114,213,661 D1153G possibly damaging Het
Acsm3 T A 7: 119,773,829 L185H probably damaging Het
Actr1a G A 19: 46,379,629 T293I probably benign Het
Adig T C 2: 158,505,916 L50P unknown Het
Ankrd28 A G 14: 31,702,202 S994P probably benign Het
Ankrd35 T A 3: 96,683,497 D366E probably damaging Het
Aqr A T 2: 114,119,946 Y927* probably null Het
Asxl2 T A 12: 3,442,529 I38N probably damaging Het
Atp9b T C 18: 80,736,842 I1092V Het
B4galnt1 A G 10: 127,171,616 E462G possibly damaging Het
BC048671 T A 6: 90,303,291 V63E probably damaging Het
BC067074 T A 13: 113,318,990 S523R Het
Bod1l A G 5: 41,831,546 V406A probably damaging Het
Btn1a1 T G 13: 23,461,498 I234L probably benign Het
Camk2b A C 11: 5,978,432 S436A probably benign Het
Cc2d1a A T 8: 84,143,745 probably null Het
Ces1b G T 8: 93,063,129 N390K probably benign Het
Chpf T C 1: 75,475,283 Q671R probably benign Het
Dbr1 C A 9: 99,583,390 N340K probably damaging Het
Dram1 T A 10: 88,340,645 T73S probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efemp1 A T 11: 28,867,501 R39S possibly damaging Het
Eif2b5 T G 16: 20,506,137 I515S possibly damaging Het
Eif2d A T 1: 131,166,374 N434I probably benign Het
Ercc6 C T 14: 32,569,805 T1042I probably benign Het
Etl4 C T 2: 20,798,638 P1057L possibly damaging Het
Fbxw16 T A 9: 109,449,023 N29I probably damaging Het
Fbxw18 T C 9: 109,688,886 D344G probably benign Het
Fgf15 G T 7: 144,899,805 V172L probably benign Het
Fmod T C 1: 134,040,240 V6A probably benign Het
Furin C A 7: 80,398,114 R86L probably benign Het
Gabrr1 T C 4: 33,160,207 V297A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Helb T C 10: 120,089,571 D967G probably benign Het
Hmcn1 T C 1: 150,563,631 T5601A possibly damaging Het
Hsbp1l1 G T 18: 80,233,419 P70Q not run Het
Hsd17b1 T C 11: 101,079,207 V155A probably damaging Het
Ireb2 T A 9: 54,882,333 M97K possibly damaging Het
Kcnj6 C A 16: 94,762,447 L397F probably benign Het
Lcorl A T 5: 45,857,459 probably null Het
Lgi2 A T 5: 52,538,411 I402N probably damaging Het
Lrat T A 3: 82,903,283 R144* probably null Het
Mfhas1 G T 8: 35,590,199 L609F probably damaging Het
Mink1 T A 11: 70,605,168 I398K possibly damaging Het
Muc5ac A T 7: 141,808,415 D1821V unknown Het
Myh2 T C 11: 67,194,728 probably null Het
Ncor1 T C 11: 62,343,218 E386G probably damaging Het
Ndufaf3 C T 9: 108,566,603 V76M probably damaging Het
Neurod4 T C 10: 130,271,022 T128A probably damaging Het
Ogfod1 T A 8: 94,038,987 D59E probably benign Het
Olfr1369-ps1 T C 13: 21,116,307 V205A probably benign Het
Olfr531 C T 7: 140,400,563 R161H probably benign Het
Olfr667 C T 7: 104,916,351 S315N probably benign Het
Pcdh15 T A 10: 74,630,690 V1513D probably benign Het
Pclo C A 5: 14,539,888 T734K unknown Het
Phc2 A G 4: 128,748,161 R759G probably benign Het
Plch1 A T 3: 63,698,954 N1176K probably benign Het
Plec T A 15: 76,174,889 Y3616F probably damaging Het
Ptpn11 G T 5: 121,144,644 T426N probably benign Het
Rictor A G 15: 6,786,981 T1245A not run Het
Rilp T C 11: 75,510,886 V164A probably damaging Het
Rnf39 A T 17: 36,947,079 T168S probably damaging Het
Rptor C G 11: 119,872,355 Q922E probably benign Het
Sall1 A T 8: 89,032,768 L236Q probably damaging Het
Skint7 A G 4: 111,988,127 T379A probably benign Het
Spata22 C A 11: 73,345,876 T336N probably damaging Het
Spata31 T C 13: 64,920,733 S232P probably benign Het
Spink5 T A 18: 43,977,655 C98S possibly damaging Het
Stard6 T C 18: 70,500,435 V171A possibly damaging Het
Tex9 A T 9: 72,480,790 probably null Het
Trak1 C T 9: 121,448,907 T353M possibly damaging Het
Trim68 A T 7: 102,678,362 Y461* probably null Het
Usp1 A G 4: 98,926,451 probably benign Het
Vmn2r42 T A 7: 8,192,642 I502F probably benign Het
Wbp4 C A 14: 79,476,821 G84C probably damaging Het
Zfp787 A G 7: 6,132,107 *382Q probably null Het
Zfp831 G T 2: 174,645,209 C559F possibly damaging Het
Zgpat G C 2: 181,366,089 A140P probably benign Het
Zscan4e T A 7: 11,307,075 Y290F probably benign Het
Other mutations in Traf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Traf7 APN 17 24510375 unclassified probably benign
IGL01821:Traf7 APN 17 24510499 missense probably damaging 0.99
IGL02263:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02307:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02321:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02323:Traf7 APN 17 24513046 missense possibly damaging 0.47
IGL02636:Traf7 APN 17 24512990 missense probably benign
R0109:Traf7 UTSW 17 24513926 missense probably benign 0.12
R0109:Traf7 UTSW 17 24513926 missense probably benign 0.12
R0193:Traf7 UTSW 17 24510551 missense probably benign 0.22
R1426:Traf7 UTSW 17 24511681 missense probably damaging 1.00
R1484:Traf7 UTSW 17 24511811 missense possibly damaging 0.86
R1574:Traf7 UTSW 17 24510553 missense probably damaging 1.00
R1574:Traf7 UTSW 17 24510553 missense probably damaging 1.00
R1728:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1729:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1784:Traf7 UTSW 17 24512379 missense probably damaging 0.98
R1959:Traf7 UTSW 17 24513281 missense probably damaging 1.00
R1994:Traf7 UTSW 17 24510502 missense probably damaging 0.99
R2484:Traf7 UTSW 17 24511639 missense probably damaging 1.00
R4682:Traf7 UTSW 17 24513374 missense probably damaging 1.00
R4778:Traf7 UTSW 17 24510438 unclassified probably benign
R4779:Traf7 UTSW 17 24510438 unclassified probably benign
R4781:Traf7 UTSW 17 24510438 unclassified probably benign
R5120:Traf7 UTSW 17 24518744 nonsense probably null
R6594:Traf7 UTSW 17 24509839 missense possibly damaging 0.92
R6885:Traf7 UTSW 17 24512292 missense probably benign 0.28
R7669:Traf7 UTSW 17 24513308 nonsense probably null
R7707:Traf7 UTSW 17 24510709 splice site probably null
Z1177:Traf7 UTSW 17 24509572 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATTTCAGATCCCGCATGGCC -3'
(R):5'- GACCAAAGTCTTCAGTGCATCC -3'

Sequencing Primer
(F):5'- CCCAGGAGTCCCTTCTAGC -3'
(R):5'- TCAGTGCATCCTATGACCGG -3'
Posted On2019-09-13