Incidental Mutation 'R0648:Acta2'
ID57386
Institutional Source Beutler Lab
Gene Symbol Acta2
Ensembl Gene ENSMUSG00000035783
Gene Nameactin, alpha 2, smooth muscle, aorta
SynonymsalphaSMA, SMalphaA, 0610041G09Rik, Actvs, a-SMA
MMRRC Submission 038833-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R0648 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34241090-34255336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34248534 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 87 (I87V)
Ref Sequence ENSEMBL: ENSMUSP00000048218 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039631]
Predicted Effect probably benign
Transcript: ENSMUST00000039631
AA Change: I87V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048218
Gene: ENSMUSG00000035783
AA Change: I87V

DomainStartEndE-ValueType
ACTIN 7 377 9.92e-237 SMART
Meta Mutation Damage Score 0.1329 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the actin family of proteins, which are highly conserved proteins that play a role in cell motility, structure and integrity. Alpha, beta and gamma actin isoforms have been identified, with alpha actins being a major constituent of the contractile apparatus, while beta and gamma actins are involved in the regulation of cell motility. This actin is an alpha actin that is found in skeletal muscle. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired vascular contractility and blood pressure homeostasis, increased blood-retina barrier permeability, and reduced retinal cone and rod function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik A G 6: 129,330,969 F46L probably benign Het
Abcc5 A G 16: 20,365,882 V1009A possibly damaging Het
Arid1a A G 4: 133,685,204 Y1560H unknown Het
Bcor C T X: 12,059,051 R102Q probably damaging Het
Camsap2 A T 1: 136,304,319 D179E probably damaging Het
Ccdc18 T A 5: 108,135,560 S46T probably damaging Het
Ccdc18 A C 5: 108,174,987 Q651P probably damaging Het
Cdc73 T C 1: 143,695,462 T80A probably benign Het
Cdh7 T A 1: 110,065,607 probably benign Het
Cenpe G A 3: 135,230,082 G426D probably damaging Het
Cenpt A G 8: 105,844,960 V487A probably damaging Het
Col4a1 G A 8: 11,246,892 P84S unknown Het
Dennd2d A G 3: 106,500,555 I450M probably damaging Het
Dhps C A 8: 85,073,282 probably null Het
Ebf1 A T 11: 44,991,510 H431L probably damaging Het
Efcab6 A G 15: 83,933,064 probably benign Het
Egflam T C 15: 7,207,709 H990R probably damaging Het
Ercc6l2 A G 13: 63,844,645 T303A probably benign Het
Fam160a1 A C 3: 85,730,614 V126G probably damaging Het
Fam167b T C 4: 129,578,357 K7E probably benign Het
Fgd3 T C 13: 49,296,573 I67V probably benign Het
Fn1 A T 1: 71,597,585 V2045D possibly damaging Het
Gm10451 A G 12: 76,451,296 noncoding transcript Het
Gm8251 A G 1: 44,056,563 S1792P possibly damaging Het
Gnl1 A G 17: 35,982,598 N225S probably damaging Het
Gpx6 A T 13: 21,318,877 N154Y probably benign Het
Haus8 C A 8: 71,256,530 G79V probably damaging Het
Hdgfl1 A T 13: 26,769,853 L79Q probably damaging Het
Hist2h2be A G 3: 96,221,535 S124G probably benign Het
Impdh2 T C 9: 108,563,466 Y83H probably benign Het
Lama2 T C 10: 26,989,376 T2929A probably benign Het
Lpin2 T C 17: 71,229,312 S199P probably benign Het
Mkl1 A G 15: 81,016,920 S457P probably damaging Het
Moap1 T C 12: 102,742,517 T258A probably benign Het
Mrps35 C A 6: 147,055,945 S156* probably null Het
Mtbp C T 15: 55,603,201 P537S probably benign Het
Ncstn C A 1: 172,067,887 V565F probably benign Het
Nhsl1 A G 10: 18,531,726 N1536S possibly damaging Het
Nkain4 T C 2: 180,943,112 Q103R possibly damaging Het
Nsun2 T A 13: 69,627,587 N383K probably damaging Het
Olfr1342 C T 4: 118,690,072 V127I probably benign Het
Olfr820 A G 10: 130,017,481 N40S probably damaging Het
Parp1 C T 1: 180,600,440 probably benign Het
Pkd1 G A 17: 24,594,937 R4125H probably damaging Het
Plxnd1 T C 6: 115,994,001 I269V possibly damaging Het
Qrich1 T A 9: 108,544,877 N563K probably damaging Het
Rab3il1 TGAAG TGAAGAAG 19: 10,027,388 probably benign Het
Rell1 G A 5: 63,924,745 T271M probably benign Het
Rgl1 A G 1: 152,536,265 probably null Het
Rph3a C T 5: 120,959,270 R261H possibly damaging Het
Ryr2 A T 13: 11,724,333 M2161K possibly damaging Het
Scaf11 T C 15: 96,418,458 N1075S possibly damaging Het
Serpina3j A G 12: 104,314,679 D37G probably benign Het
Siah2 A G 3: 58,676,214 V217A probably damaging Het
Sik2 T C 9: 50,898,745 D506G probably benign Het
Skap2 A C 6: 51,879,785 V279G probably benign Het
Slc8a3 G T 12: 81,314,446 T533N probably damaging Het
Slc9a7 A T X: 20,162,420 probably benign Het
Snai3 G T 8: 122,454,994 F241L probably damaging Het
Speg T C 1: 75,427,978 S2805P probably benign Het
Spink5 A T 18: 43,999,797 probably benign Het
Tctn1 C T 5: 122,251,698 E254K probably benign Het
Tdrd3 C T 14: 87,472,182 T100M probably damaging Het
Tex47 T C 5: 7,305,215 V132A probably benign Het
Thbs3 A G 3: 89,216,665 probably null Het
Tigit T A 16: 43,662,038 Y111F probably damaging Het
Tmem245 A G 4: 56,906,270 I148T probably benign Het
Tmem97 A G 11: 78,550,539 Y39H probably benign Het
Tnks2 T A 19: 36,862,074 probably null Het
Trp53bp1 A G 2: 121,235,707 V846A probably benign Het
Tulp2 T G 7: 45,519,786 I259S probably damaging Het
Twistnb C T 12: 33,438,000 Q305* probably null Het
Ubxn1 G A 19: 8,874,248 R215H probably damaging Het
Vmn1r17 A G 6: 57,360,475 F253L probably damaging Het
Vmn2r10 T C 5: 108,995,916 M723V probably benign Het
Xndc1 T C 7: 102,078,824 V14A possibly damaging Het
Xpnpep1 A G 19: 52,997,863 probably benign Het
Yes1 T A 5: 32,655,518 M322K possibly damaging Het
Zdhhc14 C A 17: 5,493,602 N52K probably benign Het
Zfp42 A G 8: 43,295,978 V162A probably benign Het
Other mutations in Acta2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Acta2 APN 19 34251791 missense probably damaging 0.98
IGL01802:Acta2 APN 19 34243436 missense possibly damaging 0.91
IGL01945:Acta2 APN 19 34251854 missense probably benign 0.03
IGL02136:Acta2 APN 19 34251830 missense probably damaging 1.00
IGL03114:Acta2 APN 19 34244910 critical splice donor site probably null
R1393:Acta2 UTSW 19 34241792 missense probably damaging 1.00
R1597:Acta2 UTSW 19 34252583 splice site probably benign
R2045:Acta2 UTSW 19 34243399 missense probably damaging 1.00
R2338:Acta2 UTSW 19 34248541 splice site probably benign
R3113:Acta2 UTSW 19 34243352 missense probably benign
R3940:Acta2 UTSW 19 34243480 missense possibly damaging 0.94
R3955:Acta2 UTSW 19 34251726 splice site probably benign
R4765:Acta2 UTSW 19 34246152 missense probably damaging 1.00
R4826:Acta2 UTSW 19 34251823 nonsense probably null
R6453:Acta2 UTSW 19 34246657 missense probably damaging 1.00
R6754:Acta2 UTSW 19 34244983 missense probably damaging 1.00
R6941:Acta2 UTSW 19 34252522 missense probably damaging 1.00
R7311:Acta2 UTSW 19 34241786 missense probably damaging 1.00
R7461:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7463:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7464:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7536:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7537:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7605:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7609:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7610:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7611:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7613:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7626:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7627:Acta2 UTSW 19 34252531 missense probably benign 0.00
R7803:Acta2 UTSW 19 34243418 missense probably benign
R7872:Acta2 UTSW 19 34243439 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGCCCATGCCCCAAATTCAC -3'
(R):5'- AGCCTATGTCCTTGACAAATACGCC -3'

Sequencing Primer
(F):5'- CCCCAAATTCACCAGGGTTAG -3'
(R):5'- TCTGCTACACCAATAGTTGAGC -3'
Posted On2013-07-11