Incidental Mutation 'R7396:Spink5'
ID573861
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Nameserine peptidase inhibitor, Kazal type 5
Synonyms2310065D10Rik, LEKT1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7396 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location43963235-44022501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43977655 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 98 (C98S)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069245
AA Change: C98S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: C98S

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3830403N18Rik G T X: 56,138,780 probably null Het
Abcb5 A G 12: 118,867,874 Y1248H probably damaging Het
Acacb A G 5: 114,213,661 D1153G possibly damaging Het
Acsm3 T A 7: 119,773,829 L185H probably damaging Het
Actr1a G A 19: 46,379,629 T293I probably benign Het
Adig T C 2: 158,505,916 L50P unknown Het
Ankrd28 A G 14: 31,702,202 S994P probably benign Het
Ankrd35 T A 3: 96,683,497 D366E probably damaging Het
Aqr A T 2: 114,119,946 Y927* probably null Het
Asxl2 T A 12: 3,442,529 I38N probably damaging Het
Atp9b T C 18: 80,736,842 I1092V Het
B4galnt1 A G 10: 127,171,616 E462G possibly damaging Het
BC048671 T A 6: 90,303,291 V63E probably damaging Het
BC067074 T A 13: 113,318,990 S523R Het
Bod1l A G 5: 41,831,546 V406A probably damaging Het
Btn1a1 T G 13: 23,461,498 I234L probably benign Het
Camk2b A C 11: 5,978,432 S436A probably benign Het
Ces1b G T 8: 93,063,129 N390K probably benign Het
Chpf T C 1: 75,475,283 Q671R probably benign Het
Dbr1 C A 9: 99,583,390 N340K probably damaging Het
Dram1 T A 10: 88,340,645 T73S probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Efemp1 A T 11: 28,867,501 R39S possibly damaging Het
Eif2b5 T G 16: 20,506,137 I515S possibly damaging Het
Eif2d A T 1: 131,166,374 N434I probably benign Het
Ercc6 C T 14: 32,569,805 T1042I probably benign Het
Etl4 C T 2: 20,798,638 P1057L possibly damaging Het
Fbxw16 T A 9: 109,449,023 N29I probably damaging Het
Fbxw18 T C 9: 109,688,886 D344G probably benign Het
Fgf15 G T 7: 144,899,805 V172L probably benign Het
Fmod T C 1: 134,040,240 V6A probably benign Het
Furin C A 7: 80,398,114 R86L probably benign Het
Gabrr1 T C 4: 33,160,207 V297A probably damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Helb T C 10: 120,089,571 D967G probably benign Het
Hmcn1 T C 1: 150,563,631 T5601A possibly damaging Het
Hsbp1l1 G T 18: 80,233,419 P70Q not run Het
Hsd17b1 T C 11: 101,079,207 V155A probably damaging Het
Ireb2 T A 9: 54,882,333 M97K possibly damaging Het
Kcnj6 C A 16: 94,762,447 L397F probably benign Het
Lgi2 A T 5: 52,538,411 I402N probably damaging Het
Lrat T A 3: 82,903,283 R144* probably null Het
Mfhas1 G T 8: 35,590,199 L609F probably damaging Het
Mink1 T A 11: 70,605,168 I398K possibly damaging Het
Muc5ac A T 7: 141,808,415 D1821V unknown Het
Myh2 T C 11: 67,194,728 probably null Het
Ncor1 T C 11: 62,343,218 E386G probably damaging Het
Ndufaf3 C T 9: 108,566,603 V76M probably damaging Het
Neurod4 T C 10: 130,271,022 T128A probably damaging Het
Ogfod1 T A 8: 94,038,987 D59E probably benign Het
Olfr1369-ps1 T C 13: 21,116,307 V205A probably benign Het
Olfr531 C T 7: 140,400,563 R161H probably benign Het
Olfr667 C T 7: 104,916,351 S315N probably benign Het
Pcdh15 T A 10: 74,630,690 V1513D probably benign Het
Pclo C A 5: 14,539,888 T734K unknown Het
Phc2 A G 4: 128,748,161 R759G probably benign Het
Plch1 A T 3: 63,698,954 N1176K probably benign Het
Plec T A 15: 76,174,889 Y3616F probably damaging Het
Pou3f1 GCACCACCACCACCACCAC GCACCACCACCACCAC 4: 124,659,014 probably benign Het
Ptpn11 G T 5: 121,144,644 T426N probably benign Het
Rictor A G 15: 6,786,981 T1245A not run Het
Rilp T C 11: 75,510,886 V164A probably damaging Het
Rnf39 A T 17: 36,947,079 T168S probably damaging Het
Rptor C G 11: 119,872,355 Q922E probably benign Het
Sall1 A T 8: 89,032,768 L236Q probably damaging Het
Skint7 A G 4: 111,988,127 T379A probably benign Het
Spata22 C A 11: 73,345,876 T336N probably damaging Het
Spata31 T C 13: 64,920,733 S232P probably benign Het
Stard6 T C 18: 70,500,435 V171A possibly damaging Het
Traf7 T C 17: 24,509,545 D621G probably damaging Het
Trak1 C T 9: 121,448,907 T353M possibly damaging Het
Trim68 A T 7: 102,678,362 Y461* probably null Het
Usp1 A G 4: 98,926,451 probably benign Het
Wbp4 C A 14: 79,476,821 G84C probably damaging Het
Zfp787 A G 7: 6,132,107 *382Q probably null Het
Zfp831 G T 2: 174,645,209 C559F possibly damaging Het
Zgpat G C 2: 181,366,089 A140P probably benign Het
Zscan4e T A 7: 11,307,075 Y290F probably benign Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 43987871 splice site probably benign
IGL00332:Spink5 APN 18 43967044 missense probably benign 0.00
IGL00501:Spink5 APN 18 43977739 missense probably damaging 0.98
IGL00772:Spink5 APN 18 44006420 missense probably benign 0.02
IGL00920:Spink5 APN 18 44003209 missense probably damaging 1.00
IGL00980:Spink5 APN 18 44007710 missense probably damaging 1.00
IGL01016:Spink5 APN 18 44007644 missense probably damaging 1.00
IGL01155:Spink5 APN 18 43981147 missense probably benign 0.01
IGL01374:Spink5 APN 18 43989404 missense possibly damaging 0.74
IGL01629:Spink5 APN 18 43996610 splice site probably benign
IGL01907:Spink5 APN 18 43996676 missense probably damaging 1.00
IGL01931:Spink5 APN 18 44015638 missense probably benign 0.02
IGL02237:Spink5 APN 18 44012867 missense probably benign 0.03
IGL02306:Spink5 APN 18 43964444 missense probably damaging 0.98
IGL02402:Spink5 APN 18 43967104 missense probably damaging 1.00
IGL02425:Spink5 APN 18 43990744 critical splice donor site probably null
IGL02552:Spink5 APN 18 43992168 missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44015594 missense probably benign 0.01
IGL03066:Spink5 APN 18 44016390 missense probably damaging 1.00
IGL03288:Spink5 APN 18 44014760 missense possibly damaging 0.59
crusty2 UTSW 18 43999935 splice site probably benign
R0079:Spink5 UTSW 18 43977764 missense probably damaging 1.00
R0184:Spink5 UTSW 18 44003198 missense probably benign 0.00
R0452:Spink5 UTSW 18 43963318 missense possibly damaging 0.74
R0569:Spink5 UTSW 18 43989419 missense probably damaging 1.00
R0639:Spink5 UTSW 18 44012975 splice site probably null
R0648:Spink5 UTSW 18 43999797 splice site probably benign
R0705:Spink5 UTSW 18 43992274 missense probably benign 0.01
R1170:Spink5 UTSW 18 43983563 missense probably benign 0.07
R1290:Spink5 UTSW 18 44007711 missense probably damaging 0.99
R1345:Spink5 UTSW 18 43990682 missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44007719 missense probably benign 0.01
R1530:Spink5 UTSW 18 44015671 missense probably damaging 0.96
R1570:Spink5 UTSW 18 43967107 missense probably benign 0.00
R1820:Spink5 UTSW 18 43989419 missense possibly damaging 0.94
R1843:Spink5 UTSW 18 43999891 missense probably benign 0.03
R1968:Spink5 UTSW 18 43990708 missense probably benign 0.06
R2050:Spink5 UTSW 18 44007758 critical splice donor site probably null
R2252:Spink5 UTSW 18 44020824 nonsense probably null
R2278:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2279:Spink5 UTSW 18 43986329 missense probably benign 0.07
R2696:Spink5 UTSW 18 43982292 missense probably damaging 1.00
R2992:Spink5 UTSW 18 43996629 missense probably damaging 1.00
R3422:Spink5 UTSW 18 44010244 missense probably benign 0.01
R3934:Spink5 UTSW 18 44016427 missense probably damaging 1.00
R4179:Spink5 UTSW 18 43987867 missense probably benign
R4854:Spink5 UTSW 18 44020841 makesense probably null
R5011:Spink5 UTSW 18 44006412 missense probably damaging 0.97
R5133:Spink5 UTSW 18 43986423 missense probably damaging 1.00
R5163:Spink5 UTSW 18 43999857 missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44015644 missense probably damaging 0.97
R5187:Spink5 UTSW 18 43989451 missense probably damaging 1.00
R5292:Spink5 UTSW 18 44006454 missense probably benign
R5332:Spink5 UTSW 18 43992917 missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44018711 missense probably damaging 0.96
R6267:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6296:Spink5 UTSW 18 44014757 missense probably damaging 0.99
R6373:Spink5 UTSW 18 43990672 missense probably damaging 1.00
R6982:Spink5 UTSW 18 43977725 missense probably damaging 1.00
R6982:Spink5 UTSW 18 44010042 splice site probably null
R7332:Spink5 UTSW 18 43982250 missense probably damaging 0.96
R7643:Spink5 UTSW 18 44010252 missense probably benign 0.37
R7726:Spink5 UTSW 18 43963352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGCTGGGATCATACCAAAACC -3'
(R):5'- AACAGCGTATGAATTTTGTTGGAGG -3'

Sequencing Primer
(F):5'- TGCTGGGATCATACCAAAACCATTTC -3'
(R):5'- CGTATGAATTTTGTTGGAGGTTAAC -3'
Posted On2019-09-13