Mutagenetix > Incidental Mutations

Incidental Mutation 'R7396:Spink5'

573861

Institutional Source

Beutler Lab

Gene Symbol

Spink5

Ensembl Gene

ENSMUSG00000055561

Gene Name

serine peptidase inhibitor, Kazal type 5

Synonyms

2310065D10Rik, LEKT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7396 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43963235-44022501 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 43977655 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 98 (C98S)

Ref Sequence

ENSEMBL: ENSMUSP00000066214 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069245]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069245
AA Change: C98S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: C98S

Domain	Start	End	E-Value	Type
PDB:1UUC\|A	26	77	3e-6	PDB
KAZAL	97	152	1.67e-15	SMART
KAZAL	161	216	2.07e-3	SMART
KAZAL	226	281	3.37e-11	SMART
KAZAL	298	353	2.92e-6	SMART
KAZAL	367	424	6.73e-3	SMART
KAZAL	426	480	6.07e-4	SMART
KAZAL	496	558	2.43e-1	SMART
KAZAL	559	614	2.72e-15	SMART
KAZAL	633	687	1.95e-7	SMART
KAZAL	700	755	1.01e-9	SMART
KAZAL	769	824	7.29e-7	SMART
KAZAL	865	931	1.32e-4	SMART
KAZAL	942	996	2.74e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
Abcb5	A	G	12: 118,867,874	Y1248H	probably damaging	Het
Acacb	A	G	5: 114,213,661	D1153G	possibly damaging	Het
Acsm3	T	A	7: 119,773,829	L185H	probably damaging	Het
Actr1a	G	A	19: 46,379,629	T293I	probably benign	Het
Adig	T	C	2: 158,505,916	L50P	unknown	Het
Ankrd28	A	G	14: 31,702,202	S994P	probably benign	Het
Ankrd35	T	A	3: 96,683,497	D366E	probably damaging	Het
Aqr	A	T	2: 114,119,946	Y927*	probably null	Het
Asxl2	T	A	12: 3,442,529	I38N	probably damaging	Het
Atp9b	T	C	18: 80,736,842	I1092V		Het
B4galnt1	A	G	10: 127,171,616	E462G	possibly damaging	Het
BC048671	T	A	6: 90,303,291	V63E	probably damaging	Het
BC067074	T	A	13: 113,318,990	S523R		Het
Bod1l	A	G	5: 41,831,546	V406A	probably damaging	Het
Btn1a1	T	G	13: 23,461,498	I234L	probably benign	Het
Camk2b	A	C	11: 5,978,432	S436A	probably benign	Het
Cc2d1a	A	T	8: 84,143,745		probably null	Het
Ces1b	G	T	8: 93,063,129	N390K	probably benign	Het
Chpf	T	C	1: 75,475,283	Q671R	probably benign	Het
Dbr1	C	A	9: 99,583,390	N340K	probably damaging	Het
Dram1	T	A	10: 88,340,645	T73S	probably benign	Het
E430018J23Rik	C	T	7: 127,393,324	C38Y	probably null	Het
Efemp1	A	T	11: 28,867,501	R39S	possibly damaging	Het
Eif2b5	T	G	16: 20,506,137	I515S	possibly damaging	Het
Eif2d	A	T	1: 131,166,374	N434I	probably benign	Het
Ercc6	C	T	14: 32,569,805	T1042I	probably benign	Het
Etl4	C	T	2: 20,798,638	P1057L	possibly damaging	Het
Fbxw16	T	A	9: 109,449,023	N29I	probably damaging	Het
Fbxw18	T	C	9: 109,688,886	D344G	probably benign	Het
Fgf15	G	T	7: 144,899,805	V172L	probably benign	Het
Fmod	T	C	1: 134,040,240	V6A	probably benign	Het
Furin	C	A	7: 80,398,114	R86L	probably benign	Het
Gabrr1	T	C	4: 33,160,207	V297A	probably damaging	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Helb	T	C	10: 120,089,571	D967G	probably benign	Het
Hmcn1	T	C	1: 150,563,631	T5601A	possibly damaging	Het
Hsbp1l1	G	T	18: 80,233,419	P70Q	not run	Het
Hsd17b1	T	C	11: 101,079,207	V155A	probably damaging	Het
Ireb2	T	A	9: 54,882,333	M97K	possibly damaging	Het
Kcnj6	C	A	16: 94,762,447	L397F	probably benign	Het
Lcorl	A	T	5: 45,857,459		probably null	Het
Lgi2	A	T	5: 52,538,411	I402N	probably damaging	Het
Lrat	T	A	3: 82,903,283	R144*	probably null	Het
Mfhas1	G	T	8: 35,590,199	L609F	probably damaging	Het
Mink1	T	A	11: 70,605,168	I398K	possibly damaging	Het
Muc5ac	A	T	7: 141,808,415	D1821V	unknown	Het
Myh2	T	C	11: 67,194,728		probably null	Het
Ncor1	T	C	11: 62,343,218	E386G	probably damaging	Het
Ndufaf3	C	T	9: 108,566,603	V76M	probably damaging	Het
Neurod4	T	C	10: 130,271,022	T128A	probably damaging	Het
Ogfod1	T	A	8: 94,038,987	D59E	probably benign	Het
Olfr1369-ps1	T	C	13: 21,116,307	V205A	probably benign	Het
Olfr531	C	T	7: 140,400,563	R161H	probably benign	Het
Olfr667	C	T	7: 104,916,351	S315N	probably benign	Het
Pcdh15	T	A	10: 74,630,690	V1513D	probably benign	Het
Pclo	C	A	5: 14,539,888	T734K	unknown	Het
Phc2	A	G	4: 128,748,161	R759G	probably benign	Het
Plch1	A	T	3: 63,698,954	N1176K	probably benign	Het
Plec	T	A	15: 76,174,889	Y3616F	probably damaging	Het
Ptpn11	G	T	5: 121,144,644	T426N	probably benign	Het
Rictor	A	G	15: 6,786,981	T1245A	not run	Het
Rilp	T	C	11: 75,510,886	V164A	probably damaging	Het
Rnf39	A	T	17: 36,947,079	T168S	probably damaging	Het
Rptor	C	G	11: 119,872,355	Q922E	probably benign	Het
Sall1	A	T	8: 89,032,768	L236Q	probably damaging	Het
Skint7	A	G	4: 111,988,127	T379A	probably benign	Het
Spata22	C	A	11: 73,345,876	T336N	probably damaging	Het
Spata31	T	C	13: 64,920,733	S232P	probably benign	Het
Stard6	T	C	18: 70,500,435	V171A	possibly damaging	Het
Tex9	A	T	9: 72,480,790		probably null	Het
Traf7	T	C	17: 24,509,545	D621G	probably damaging	Het
Trak1	C	T	9: 121,448,907	T353M	possibly damaging	Het
Trim68	A	T	7: 102,678,362	Y461*	probably null	Het
Usp1	A	G	4: 98,926,451		probably benign	Het
Vmn2r42	T	A	7: 8,192,642	I502F	probably benign	Het
Wbp4	C	A	14: 79,476,821	G84C	probably damaging	Het
Zfp787	A	G	7: 6,132,107	*382Q	probably null	Het
Zfp831	G	T	2: 174,645,209	C559F	possibly damaging	Het
Zgpat	G	C	2: 181,366,089	A140P	probably benign	Het
Zscan4e	T	A	7: 11,307,075	Y290F	probably benign	Het

Other mutations in Spink5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Spink5	APN	18	43987871	splice site	probably benign
IGL00332:Spink5	APN	18	43967044	missense	probably benign	0.00
IGL00501:Spink5	APN	18	43977739	missense	probably damaging	0.98
IGL00772:Spink5	APN	18	44006420	missense	probably benign	0.02
IGL00920:Spink5	APN	18	44003209	missense	probably damaging	1.00
IGL00980:Spink5	APN	18	44007710	missense	probably damaging	1.00
IGL01016:Spink5	APN	18	44007644	missense	probably damaging	1.00
IGL01155:Spink5	APN	18	43981147	missense	probably benign	0.01
IGL01374:Spink5	APN	18	43989404	missense	possibly damaging	0.74
IGL01629:Spink5	APN	18	43996610	splice site	probably benign
IGL01907:Spink5	APN	18	43996676	missense	probably damaging	1.00
IGL01931:Spink5	APN	18	44015638	missense	probably benign	0.02
IGL02237:Spink5	APN	18	44012867	missense	probably benign	0.03
IGL02306:Spink5	APN	18	43964444	missense	probably damaging	0.98
IGL02402:Spink5	APN	18	43967104	missense	probably damaging	1.00
IGL02425:Spink5	APN	18	43990744	critical splice donor site	probably null
IGL02552:Spink5	APN	18	43992168	missense	possibly damaging	0.80
IGL02554:Spink5	APN	18	44015594	missense	probably benign	0.01
IGL03066:Spink5	APN	18	44016390	missense	probably damaging	1.00
IGL03288:Spink5	APN	18	44014760	missense	possibly damaging	0.59
crusty2	UTSW	18	43999935	splice site	probably benign
R0079:Spink5	UTSW	18	43977764	missense	probably damaging	1.00
R0184:Spink5	UTSW	18	44003198	missense	probably benign	0.00
R0452:Spink5	UTSW	18	43963318	missense	possibly damaging	0.74
R0569:Spink5	UTSW	18	43989419	missense	probably damaging	1.00
R0639:Spink5	UTSW	18	44012975	splice site	probably null
R0648:Spink5	UTSW	18	43999797	splice site	probably benign
R0705:Spink5	UTSW	18	43992274	missense	probably benign	0.01
R1170:Spink5	UTSW	18	43983563	missense	probably benign	0.07
R1290:Spink5	UTSW	18	44007711	missense	probably damaging	0.99
R1345:Spink5	UTSW	18	43990682	missense	possibly damaging	0.88
R1458:Spink5	UTSW	18	44007719	missense	probably benign	0.01
R1530:Spink5	UTSW	18	44015671	missense	probably damaging	0.96
R1570:Spink5	UTSW	18	43967107	missense	probably benign	0.00
R1820:Spink5	UTSW	18	43989419	missense	possibly damaging	0.94
R1843:Spink5	UTSW	18	43999891	missense	probably benign	0.03
R1968:Spink5	UTSW	18	43990708	missense	probably benign	0.06
R2050:Spink5	UTSW	18	44007758	critical splice donor site	probably null
R2252:Spink5	UTSW	18	44020824	nonsense	probably null
R2278:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2279:Spink5	UTSW	18	43986329	missense	probably benign	0.07
R2696:Spink5	UTSW	18	43982292	missense	probably damaging	1.00
R2992:Spink5	UTSW	18	43996629	missense	probably damaging	1.00
R3422:Spink5	UTSW	18	44010244	missense	probably benign	0.01
R3934:Spink5	UTSW	18	44016427	missense	probably damaging	1.00
R4179:Spink5	UTSW	18	43987867	missense	probably benign
R4854:Spink5	UTSW	18	44020841	makesense	probably null
R5011:Spink5	UTSW	18	44006412	missense	probably damaging	0.97
R5133:Spink5	UTSW	18	43986423	missense	probably damaging	1.00
R5163:Spink5	UTSW	18	43999857	missense	possibly damaging	0.95
R5185:Spink5	UTSW	18	44015644	missense	probably damaging	0.97
R5187:Spink5	UTSW	18	43989451	missense	probably damaging	1.00
R5292:Spink5	UTSW	18	44006454	missense	probably benign
R5332:Spink5	UTSW	18	43992917	missense	possibly damaging	0.89
R5600:Spink5	UTSW	18	44018711	missense	probably damaging	0.96
R6267:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6296:Spink5	UTSW	18	44014757	missense	probably damaging	0.99
R6373:Spink5	UTSW	18	43990672	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	43977725	missense	probably damaging	1.00
R6982:Spink5	UTSW	18	44010042	splice site	probably null
R7332:Spink5	UTSW	18	43982250	missense	probably damaging	0.96
R7643:Spink5	UTSW	18	44010252	missense	probably benign	0.37
R7726:Spink5	UTSW	18	43963352	missense	probably damaging	1.00
R7828:Spink5	UTSW	18	44010229	missense	probably benign	0.15
R7836:Spink5	UTSW	18	43999821	missense	probably benign	0.00
R7880:Spink5	UTSW	18	43986326	missense	probably benign	0.40
R8031:Spink5	UTSW	18	44010236	missense	probably benign	0.07
R8198:Spink5	UTSW	18	43992880	missense	probably benign	0.17
R8361:Spink5	UTSW	18	43989462	missense	probably damaging	1.00
R8375:Spink5	UTSW	18	43990719	missense	probably benign	0.01
R8684:Spink5	UTSW	18	44010238	missense	probably benign	0.02
R8749:Spink5	UTSW	18	43989358	nonsense	probably null
Z1177:Spink5	UTSW	18	43996635	missense	probably damaging	0.97
Z1177:Spink5	UTSW	18	43996697	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATTGCTGGGATCATACCAAAACC -3'
(R):5'- AACAGCGTATGAATTTTGTTGGAGG -3'

Sequencing Primer
(F):5'- TGCTGGGATCATACCAAAACCATTTC -3'
(R):5'- CGTATGAATTTTGTTGGAGGTTAAC -3'

Posted On

2019-09-13