Incidental Mutation 'R7397:Nlrp10'
ID573890
Institutional Source Beutler Lab
Gene Symbol Nlrp10
Ensembl Gene ENSMUSG00000049709
Gene NameNLR family, pyrin domain containing 10
SynonymsNalp10, 6430548I20Rik, Pynod
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7397 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location108921852-108930178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108924692 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 527 (L527P)
Ref Sequence ENSEMBL: ENSMUSP00000050252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055745]
PDB Structure
Solution structure of the Pyrin/PAAD-DAPIN domain in mouse NALP10 (NACHT, leucine rich repeat and PYD containing 10) [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000055745
AA Change: L527P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050252
Gene: ENSMUSG00000049709
AA Change: L527P

DomainStartEndE-ValueType
PYRIN 9 88 4.13e-18 SMART
low complexity region 126 137 N/A INTRINSIC
AAA 161 302 1.07e-2 SMART
low complexity region 576 597 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). The protein encoded by this gene belongs to the NALP protein family despite lacking the LRR region. This protein likely plays a regulatory role in the innate immune system. The protein belongs to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. Other experiments indicate that this gene acts as a multifunctional negative regulator of inflammation and apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display a global defect in adaptive immune responses with impaired dendritic cell migration to lymph nodes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,543,548 I102N probably benign Het
1700080E11Rik A T 9: 105,144,422 W142R probably damaging Het
6430550D23Rik T C 2: 156,003,928 H3R unknown Het
Adam18 T A 8: 24,646,305 E400V possibly damaging Het
Ak5 A T 3: 152,478,352 F473I probably damaging Het
Arhgef10l G A 4: 140,562,804 P486S probably damaging Het
Asphd1 T A 7: 126,948,829 R101W possibly damaging Het
Bhlha15 G A 5: 144,191,405 E112K probably damaging Het
C4b A T 17: 34,742,390 D198E possibly damaging Het
Carmil1 G T 13: 24,044,311 P961T probably damaging Het
Catsperb T C 12: 101,588,023 S659P possibly damaging Het
Cdh3 C T 8: 106,536,609 R97* probably null Het
Cep192 T C 18: 67,856,197 I1805T probably damaging Het
Cep250 T G 2: 155,981,411 L995R probably damaging Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chd5 A G 4: 152,368,012 K809E possibly damaging Het
Csmd3 T C 15: 47,695,734 T1467A Het
Ctla2a T A 13: 60,935,649 R60S probably damaging Het
Cts6 A T 13: 61,202,200 D22E possibly damaging Het
Ctsll3 T A 13: 60,800,718 E109V probably benign Het
Dgka G A 10: 128,720,725 P701S possibly damaging Het
Dnhd1 A T 7: 105,705,297 I3089F possibly damaging Het
Dock2 T A 11: 34,718,989 D208V probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fnbp1l G T 3: 122,544,637 Q520K probably benign Het
Foxc1 A G 13: 31,807,635 D143G probably damaging Het
Fsip2 G A 2: 82,985,257 R3778Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm4871 A T 5: 145,032,698 C4S probably damaging Het
Gpt C A 15: 76,698,517 T294K probably benign Het
Hsd17b4 G T 18: 50,146,424 G157C probably damaging Het
Iars G A 13: 49,728,677 E1066K probably benign Het
Ifih1 G A 2: 62,623,488 T260I possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Kif20a A G 18: 34,627,676 T166A probably damaging Het
Map3k1 G A 13: 111,755,208 A1171V probably damaging Het
Map3k21 T C 8: 125,935,116 F484S probably damaging Het
Mbnl1 A T 3: 60,615,630 Q180L probably benign Het
Mmp2 T C 8: 92,836,127 F331L possibly damaging Het
Ms4a7 G T 19: 11,321,552 H257N probably benign Het
Mtbp T A 15: 55,569,151 S285T probably benign Het
Myo1c A G 11: 75,671,242 N852S probably benign Het
Myom3 T A 4: 135,783,118 F574Y probably damaging Het
Nbeal2 A G 9: 110,628,032 I2322T possibly damaging Het
Nxnl1 C T 8: 71,566,461 G40D probably damaging Het
Olfr312 C T 11: 58,831,289 T45M probably benign Het
Otof A T 5: 30,375,707 W1564R probably damaging Het
Pcdhga7 A G 18: 37,717,274 Y778C probably benign Het
Pdpr T A 8: 111,112,753 N169K possibly damaging Het
Pkd1l2 C A 8: 117,035,902 V1379F possibly damaging Het
Ppp4r1 T G 17: 65,837,791 I801S probably benign Het
Ppp4r4 A T 12: 103,612,806 probably null Het
Prl2c5 A G 13: 13,191,742 D202G probably benign Het
Rap1gap2 T C 11: 74,414,411 T323A probably benign Het
Rapgef4 T C 2: 72,205,666 M501T probably benign Het
Rbm6 A G 9: 107,852,519 M310T probably benign Het
Rdh1 A T 10: 127,760,178 I81F probably benign Het
Rock1 C T 18: 10,097,599 A730T possibly damaging Het
Rsl1 C T 13: 67,182,037 T183I possibly damaging Het
Skiv2l2 A T 13: 112,921,686 D70E probably benign Het
Snap29 T C 16: 17,419,372 F116L probably damaging Het
Tat T C 8: 109,997,568 L363P probably damaging Het
Ttn A G 2: 76,770,972 V18719A possibly damaging Het
Ube2e2 T A 14: 18,630,339 D107V probably damaging Het
Vmn1r64 A G 7: 5,884,014 S177P possibly damaging Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Vmn2r124 T C 17: 18,062,685 W214R probably damaging Het
Vmn2r25 A T 6: 123,823,539 F615I probably damaging Het
Vmn2r91 G T 17: 18,135,798 V576L probably benign Het
Vsig10l A C 7: 43,468,007 T573P probably damaging Het
Wdr93 A G 7: 79,766,424 Q276R probably null Het
Zc3h7b T C 15: 81,769,153 V86A possibly damaging Het
Zeb1 T A 18: 5,761,394 Y231N probably damaging Het
Zfp407 T C 18: 84,561,819 K390E possibly damaging Het
Other mutations in Nlrp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Nlrp10 APN 7 108924581 missense possibly damaging 0.86
IGL01482:Nlrp10 APN 7 108926952 missense probably benign
IGL02043:Nlrp10 APN 7 108925502 missense probably damaging 0.99
IGL03129:Nlrp10 APN 7 108924911 missense probably damaging 1.00
IGL02835:Nlrp10 UTSW 7 108924662 missense possibly damaging 0.61
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0106:Nlrp10 UTSW 7 108925322 missense possibly damaging 0.94
R0540:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R0607:Nlrp10 UTSW 7 108924285 missense probably benign 0.26
R1166:Nlrp10 UTSW 7 108925010 missense probably damaging 1.00
R1248:Nlrp10 UTSW 7 108925881 missense probably benign 0.08
R1450:Nlrp10 UTSW 7 108925388 missense probably damaging 0.98
R1459:Nlrp10 UTSW 7 108924348 missense probably benign
R1567:Nlrp10 UTSW 7 108927050 missense probably benign 0.02
R1635:Nlrp10 UTSW 7 108924530 missense possibly damaging 0.93
R1845:Nlrp10 UTSW 7 108927041 missense probably damaging 1.00
R1912:Nlrp10 UTSW 7 108925395 nonsense probably null
R1952:Nlrp10 UTSW 7 108924563 missense probably benign 0.20
R1953:Nlrp10 UTSW 7 108925118 missense probably benign 0.00
R2079:Nlrp10 UTSW 7 108925628 missense possibly damaging 0.66
R3615:Nlrp10 UTSW 7 108924476 missense probably benign
R3616:Nlrp10 UTSW 7 108924476 missense probably benign
R4207:Nlrp10 UTSW 7 108924341 missense possibly damaging 0.56
R4786:Nlrp10 UTSW 7 108925238 missense probably damaging 1.00
R5048:Nlrp10 UTSW 7 108924565 missense probably benign 0.01
R5568:Nlrp10 UTSW 7 108924261 missense probably benign 0.00
R5993:Nlrp10 UTSW 7 108927013 missense probably benign 0.00
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6033:Nlrp10 UTSW 7 108924577 missense probably benign 0.17
R6170:Nlrp10 UTSW 7 108924464 missense probably benign 0.00
R6320:Nlrp10 UTSW 7 108925746 missense possibly damaging 0.82
R6935:Nlrp10 UTSW 7 108926900 missense probably damaging 0.99
R7024:Nlrp10 UTSW 7 108925198 missense possibly damaging 0.73
R7081:Nlrp10 UTSW 7 108924648 missense probably benign 0.02
R7720:Nlrp10 UTSW 7 108924488 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- GAATGGACTTTGTACCTTCCCG -3'
(R):5'- CTTGTGAAGGAGGACCAGAGTC -3'

Sequencing Primer
(F):5'- AGCTGCTTGTCACTGAAACTGAC -3'
(R):5'- TCAGCAGGGAGAGGCCAC -3'
Posted On2019-09-13