Incidental Mutation 'R7397:Foxc1'
ID573915
Institutional Source Beutler Lab
Gene Symbol Foxc1
Ensembl Gene ENSMUSG00000050295
Gene Nameforkhead box C1
Synonymsfrkhda, fkh-1, Mf1, Mf4, FREAC3, Fkh1, fkh1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7397 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location31806633-31812476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31807635 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 143 (D143G)
Ref Sequence ENSEMBL: ENSMUSP00000052196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062292]
Predicted Effect probably damaging
Transcript: ENSMUST00000062292
AA Change: D143G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000052196
Gene: ENSMUSG00000050295
AA Change: D143G

DomainStartEndE-ValueType
low complexity region 28 36 N/A INTRINSIC
FH 76 166 4e-64 SMART
low complexity region 169 186 N/A INTRINSIC
low complexity region 193 218 N/A INTRINSIC
low complexity region 236 254 N/A INTRINSIC
low complexity region 261 287 N/A INTRINSIC
low complexity region 289 302 N/A INTRINSIC
low complexity region 323 345 N/A INTRINSIC
low complexity region 352 398 N/A INTRINSIC
low complexity region 415 426 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 486 495 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct DNA-binding forkhead domain. The specific function of this gene has not yet been determined; however, it has been shown to play a role in the regulation of embryonic and ocular development. Mutations in this gene cause various glaucoma phenotypes including primary congenital glaucoma, autosomal dominant iridogoniodysgenesis anomaly, and Axenfeld-Rieger anomaly. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are neonatal lethal with congenital hydrocephalus, edema, abnormalities of the eye, skull, axial skeleton, kidney-ureter and cardiovascular systems. Heterozygotes have variable milder defects depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,543,548 I102N probably benign Het
1700080E11Rik A T 9: 105,144,422 W142R probably damaging Het
6430550D23Rik T C 2: 156,003,928 H3R unknown Het
Adam18 T A 8: 24,646,305 E400V possibly damaging Het
Ak5 A T 3: 152,478,352 F473I probably damaging Het
Arhgef10l G A 4: 140,562,804 P486S probably damaging Het
Asphd1 T A 7: 126,948,829 R101W possibly damaging Het
Bhlha15 G A 5: 144,191,405 E112K probably damaging Het
C4b A T 17: 34,742,390 D198E possibly damaging Het
Carmil1 G T 13: 24,044,311 P961T probably damaging Het
Catsperb T C 12: 101,588,023 S659P possibly damaging Het
Cdh3 C T 8: 106,536,609 R97* probably null Het
Cep192 T C 18: 67,856,197 I1805T probably damaging Het
Cep250 T G 2: 155,981,411 L995R probably damaging Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chd5 A G 4: 152,368,012 K809E possibly damaging Het
Csmd3 T C 15: 47,695,734 T1467A Het
Ctla2a T A 13: 60,935,649 R60S probably damaging Het
Cts6 A T 13: 61,202,200 D22E possibly damaging Het
Ctsll3 T A 13: 60,800,718 E109V probably benign Het
Dgka G A 10: 128,720,725 P701S possibly damaging Het
Dnhd1 A T 7: 105,705,297 I3089F possibly damaging Het
Dock2 T A 11: 34,718,989 D208V probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fnbp1l G T 3: 122,544,637 Q520K probably benign Het
Fsip2 G A 2: 82,985,257 R3778Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm4871 A T 5: 145,032,698 C4S probably damaging Het
Gpt C A 15: 76,698,517 T294K probably benign Het
Hsd17b4 G T 18: 50,146,424 G157C probably damaging Het
Iars G A 13: 49,728,677 E1066K probably benign Het
Ifih1 G A 2: 62,623,488 T260I possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Kif20a A G 18: 34,627,676 T166A probably damaging Het
Map3k1 G A 13: 111,755,208 A1171V probably damaging Het
Map3k21 T C 8: 125,935,116 F484S probably damaging Het
Mbnl1 A T 3: 60,615,630 Q180L probably benign Het
Mmp2 T C 8: 92,836,127 F331L possibly damaging Het
Ms4a7 G T 19: 11,321,552 H257N probably benign Het
Mtbp T A 15: 55,569,151 S285T probably benign Het
Myo1c A G 11: 75,671,242 N852S probably benign Het
Myom3 T A 4: 135,783,118 F574Y probably damaging Het
Nbeal2 A G 9: 110,628,032 I2322T possibly damaging Het
Nlrp10 A G 7: 108,924,692 L527P probably damaging Het
Nxnl1 C T 8: 71,566,461 G40D probably damaging Het
Olfr312 C T 11: 58,831,289 T45M probably benign Het
Otof A T 5: 30,375,707 W1564R probably damaging Het
Pcdhga7 A G 18: 37,717,274 Y778C probably benign Het
Pdpr T A 8: 111,112,753 N169K possibly damaging Het
Pkd1l2 C A 8: 117,035,902 V1379F possibly damaging Het
Ppp4r1 T G 17: 65,837,791 I801S probably benign Het
Ppp4r4 A T 12: 103,612,806 probably null Het
Prl2c5 A G 13: 13,191,742 D202G probably benign Het
Rap1gap2 T C 11: 74,414,411 T323A probably benign Het
Rapgef4 T C 2: 72,205,666 M501T probably benign Het
Rbm6 A G 9: 107,852,519 M310T probably benign Het
Rdh1 A T 10: 127,760,178 I81F probably benign Het
Rock1 C T 18: 10,097,599 A730T possibly damaging Het
Rsl1 C T 13: 67,182,037 T183I possibly damaging Het
Skiv2l2 A T 13: 112,921,686 D70E probably benign Het
Snap29 T C 16: 17,419,372 F116L probably damaging Het
Tat T C 8: 109,997,568 L363P probably damaging Het
Ttn A G 2: 76,770,972 V18719A possibly damaging Het
Ube2e2 T A 14: 18,630,339 D107V probably damaging Het
Vmn1r64 A G 7: 5,884,014 S177P possibly damaging Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Vmn2r124 T C 17: 18,062,685 W214R probably damaging Het
Vmn2r25 A T 6: 123,823,539 F615I probably damaging Het
Vmn2r91 G T 17: 18,135,798 V576L probably benign Het
Vsig10l A C 7: 43,468,007 T573P probably damaging Het
Wdr93 A G 7: 79,766,424 Q276R probably null Het
Zc3h7b T C 15: 81,769,153 V86A possibly damaging Het
Zeb1 T A 18: 5,761,394 Y231N probably damaging Het
Zfp407 T C 18: 84,561,819 K390E possibly damaging Het
Other mutations in Foxc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01859:Foxc1 APN 13 31808723 missense unknown
R0369:Foxc1 UTSW 13 31807512 missense probably damaging 0.99
R1217:Foxc1 UTSW 13 31808685 missense unknown
R1489:Foxc1 UTSW 13 31808612 nonsense probably null
R1696:Foxc1 UTSW 13 31808799 missense unknown
R1884:Foxc1 UTSW 13 31807665 missense probably damaging 0.98
R2163:Foxc1 UTSW 13 31808603 missense unknown
R2442:Foxc1 UTSW 13 31808798 missense unknown
R4210:Foxc1 UTSW 13 31807707 missense probably damaging 1.00
R5562:Foxc1 UTSW 13 31807590 missense probably damaging 1.00
R5717:Foxc1 UTSW 13 31807488 missense probably benign 0.25
R6865:Foxc1 UTSW 13 31808853 missense unknown
R7289:Foxc1 UTSW 13 31807260 missense probably damaging 1.00
R7469:Foxc1 UTSW 13 31808378 missense unknown
R7469:Foxc1 UTSW 13 31808379 missense unknown
X0063:Foxc1 UTSW 13 31807556 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- ACATCGCTCTTATCACCATGGC -3'
(R):5'- TTGATGTCCTGGATGCGCAC -3'

Sequencing Primer
(F):5'- TGGCCATCCAGAATGCCC -3'
(R):5'- GTCCTTCTTCTTGAAGCGCC -3'
Posted On2019-09-13