Incidental Mutation 'R7397:Vmn2r91'
ID573930
Institutional Source Beutler Lab
Gene Symbol Vmn2r91
Ensembl Gene ENSMUSG00000091206
Gene Namevomeronasal 2, receptor 91
SynonymsEG665210
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7397 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location18085057-18136643 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 18135798 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 576 (V576L)
Ref Sequence ENSEMBL: ENSMUSP00000127465 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172359]
Predicted Effect probably benign
Transcript: ENSMUST00000172359
AA Change: V576L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000127465
Gene: ENSMUSG00000091206
AA Change: V576L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 83 462 2.2e-38 PFAM
Pfam:NCD3G 510 564 6.7e-20 PFAM
Pfam:7tm_3 597 832 2.1e-53 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (77/77)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,543,548 I102N probably benign Het
1700080E11Rik A T 9: 105,144,422 W142R probably damaging Het
6430550D23Rik T C 2: 156,003,928 H3R unknown Het
Adam18 T A 8: 24,646,305 E400V possibly damaging Het
Ak5 A T 3: 152,478,352 F473I probably damaging Het
Arhgef10l G A 4: 140,562,804 P486S probably damaging Het
Asphd1 T A 7: 126,948,829 R101W possibly damaging Het
Bhlha15 G A 5: 144,191,405 E112K probably damaging Het
C4b A T 17: 34,742,390 D198E possibly damaging Het
Carmil1 G T 13: 24,044,311 P961T probably damaging Het
Catsperb T C 12: 101,588,023 S659P possibly damaging Het
Cdh3 C T 8: 106,536,609 R97* probably null Het
Cep192 T C 18: 67,856,197 I1805T probably damaging Het
Cep250 T G 2: 155,981,411 L995R probably damaging Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chd5 A G 4: 152,368,012 K809E possibly damaging Het
Csmd3 T C 15: 47,695,734 T1467A Het
Ctla2a T A 13: 60,935,649 R60S probably damaging Het
Cts6 A T 13: 61,202,200 D22E possibly damaging Het
Ctsll3 T A 13: 60,800,718 E109V probably benign Het
Dgka G A 10: 128,720,725 P701S possibly damaging Het
Dnhd1 A T 7: 105,705,297 I3089F possibly damaging Het
Dock2 T A 11: 34,718,989 D208V probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fnbp1l G T 3: 122,544,637 Q520K probably benign Het
Foxc1 A G 13: 31,807,635 D143G probably damaging Het
Fsip2 G A 2: 82,985,257 R3778Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm4871 A T 5: 145,032,698 C4S probably damaging Het
Gpt C A 15: 76,698,517 T294K probably benign Het
Hsd17b4 G T 18: 50,146,424 G157C probably damaging Het
Iars G A 13: 49,728,677 E1066K probably benign Het
Ifih1 G A 2: 62,623,488 T260I possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Ipcef1 T A 10: 6,972,244 *338R probably null Het
Kif20a A G 18: 34,627,676 T166A probably damaging Het
Map3k1 G A 13: 111,755,208 A1171V probably damaging Het
Map3k21 T C 8: 125,935,116 F484S probably damaging Het
Mbnl1 A T 3: 60,615,630 Q180L probably benign Het
Mmp2 T C 8: 92,836,127 F331L possibly damaging Het
Ms4a7 G T 19: 11,321,552 H257N probably benign Het
Mtbp T A 15: 55,569,151 S285T probably benign Het
Myo1c A G 11: 75,671,242 N852S probably benign Het
Myom3 T A 4: 135,783,118 F574Y probably damaging Het
Nbeal2 A G 9: 110,628,032 I2322T possibly damaging Het
Nlrp10 A G 7: 108,924,692 L527P probably damaging Het
Nxnl1 C T 8: 71,566,461 G40D probably damaging Het
Olfr312 C T 11: 58,831,289 T45M probably benign Het
Olfr664 C T 7: 104,733,608 C252Y possibly damaging Het
Otof A T 5: 30,375,707 W1564R probably damaging Het
Pcdhga7 A G 18: 37,717,274 Y778C probably benign Het
Pcnx2 C T 8: 125,890,885 probably null Het
Pdpr T A 8: 111,112,753 N169K possibly damaging Het
Pkd1l2 C A 8: 117,035,902 V1379F possibly damaging Het
Ppp4r1 T G 17: 65,837,791 I801S probably benign Het
Ppp4r4 A T 12: 103,612,806 probably null Het
Prl2c5 A G 13: 13,191,742 D202G probably benign Het
Rap1gap2 T C 11: 74,414,411 T323A probably benign Het
Rapgef4 T C 2: 72,205,666 M501T probably benign Het
Rbm6 A G 9: 107,852,519 M310T probably benign Het
Rdh1 A T 10: 127,760,178 I81F probably benign Het
Rock1 C T 18: 10,097,599 A730T possibly damaging Het
Rsl1 C T 13: 67,182,037 T183I possibly damaging Het
Scyl3 T C 1: 163,950,918 probably null Het
Skiv2l2 A T 13: 112,921,686 D70E probably benign Het
Snap29 T C 16: 17,419,372 F116L probably damaging Het
Syt5 A T 7: 4,542,396 probably null Het
Tat T C 8: 109,997,568 L363P probably damaging Het
Ttn A G 2: 76,770,972 V18719A possibly damaging Het
Ube2e2 T A 14: 18,630,339 D107V probably damaging Het
Vmn1r64 A G 7: 5,884,014 S177P possibly damaging Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Vmn2r124 T C 17: 18,062,685 W214R probably damaging Het
Vmn2r25 A T 6: 123,823,539 F615I probably damaging Het
Vsig10l A C 7: 43,468,007 T573P probably damaging Het
Wdr93 A G 7: 79,766,424 Q276R probably null Het
Zc3h7b T C 15: 81,769,153 V86A possibly damaging Het
Zeb1 T A 18: 5,761,394 Y231N probably damaging Het
Zfp407 T C 18: 84,561,819 K390E possibly damaging Het
Other mutations in Vmn2r91
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Vmn2r91 APN 17 18105558 missense probably benign 0.00
IGL01121:Vmn2r91 APN 17 18136504 missense possibly damaging 0.94
IGL01464:Vmn2r91 APN 17 18107602 missense probably null 0.00
IGL02003:Vmn2r91 APN 17 18107659 missense probably benign
IGL02709:Vmn2r91 APN 17 18105449 missense possibly damaging 0.74
IGL02795:Vmn2r91 APN 17 18085277 missense probably benign 0.01
IGL02813:Vmn2r91 APN 17 18136086 missense possibly damaging 0.91
IGL02830:Vmn2r91 APN 17 18136622 missense probably benign 0.01
IGL03130:Vmn2r91 APN 17 18110111 splice site probably benign
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0164:Vmn2r91 UTSW 17 18106137 missense probably benign 0.00
R0393:Vmn2r91 UTSW 17 18105450 missense probably damaging 1.00
R1142:Vmn2r91 UTSW 17 18136443 missense probably damaging 1.00
R1603:Vmn2r91 UTSW 17 18106143 missense probably benign 0.04
R1992:Vmn2r91 UTSW 17 18135880 missense probably damaging 1.00
R2182:Vmn2r91 UTSW 17 18105429 missense possibly damaging 0.94
R2424:Vmn2r91 UTSW 17 18136169 nonsense probably null
R2512:Vmn2r91 UTSW 17 18135786 missense probably benign
R2885:Vmn2r91 UTSW 17 18105366 missense probably benign 0.00
R2909:Vmn2r91 UTSW 17 18136399 missense probably damaging 1.00
R3009:Vmn2r91 UTSW 17 18105455 missense probably benign 0.11
R3079:Vmn2r91 UTSW 17 18135711 splice site probably null
R3080:Vmn2r91 UTSW 17 18135711 splice site probably null
R3434:Vmn2r91 UTSW 17 18110108 splice site probably benign
R3723:Vmn2r91 UTSW 17 18085278 critical splice donor site probably null
R3829:Vmn2r91 UTSW 17 18105497 missense probably damaging 1.00
R3845:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R3846:Vmn2r91 UTSW 17 18107598 missense probably benign 0.00
R4118:Vmn2r91 UTSW 17 18110096 missense probably damaging 1.00
R4285:Vmn2r91 UTSW 17 18135768 missense probably benign 0.00
R4729:Vmn2r91 UTSW 17 18107644 missense probably damaging 1.00
R4793:Vmn2r91 UTSW 17 18105396 missense probably damaging 1.00
R4932:Vmn2r91 UTSW 17 18136489 missense possibly damaging 0.84
R5016:Vmn2r91 UTSW 17 18110060 nonsense probably null
R5018:Vmn2r91 UTSW 17 18136438 missense probably damaging 1.00
R5605:Vmn2r91 UTSW 17 18136501 missense probably damaging 1.00
R5815:Vmn2r91 UTSW 17 18106202 missense probably benign 0.01
R6146:Vmn2r91 UTSW 17 18136256 missense probably benign 0.07
R6187:Vmn2r91 UTSW 17 18106626 missense probably benign 0.05
R6426:Vmn2r91 UTSW 17 18135603 intron probably null
R6450:Vmn2r91 UTSW 17 18085265 missense probably damaging 0.98
R6767:Vmn2r91 UTSW 17 18107545 missense probably damaging 0.98
R6986:Vmn2r91 UTSW 17 18136009 missense probably benign 0.10
R7112:Vmn2r91 UTSW 17 18105618 missense possibly damaging 0.83
R7178:Vmn2r91 UTSW 17 18136162 missense probably damaging 1.00
R7330:Vmn2r91 UTSW 17 18106167 missense probably damaging 1.00
R7368:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7380:Vmn2r91 UTSW 17 18136576 nonsense probably null
R7625:Vmn2r91 UTSW 17 18105431 missense probably damaging 1.00
R7739:Vmn2r91 UTSW 17 18135818 missense probably benign 0.00
R7749:Vmn2r91 UTSW 17 18136278 missense possibly damaging 0.75
R7755:Vmn2r91 UTSW 17 18110049 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TGCCATGACTTCTGAGATAGTC -3'
(R):5'- GCAAAGGTGGTCTGCTGAAG -3'

Sequencing Primer
(F):5'- ACTTCTGAGATAGTCCCTGTAATTAG -3'
(R):5'- GCTGACCAATGAAGTTCAAAGAAC -3'
Posted On2019-09-13