Incidental Mutation 'R7397:Ppp4r1'
ID573932
Institutional Source Beutler Lab
Gene Symbol Ppp4r1
Ensembl Gene ENSMUSG00000061950
Gene Nameprotein phosphatase 4, regulatory subunit 1
SynonymsPp4r1, 3110001J10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7397 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location65782573-65841926 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 65837791 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 801 (I801S)
Ref Sequence ENSEMBL: ENSMUSP00000072848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073104] [ENSMUST00000160664] [ENSMUST00000162109] [ENSMUST00000162703]
Predicted Effect probably benign
Transcript: ENSMUST00000073104
AA Change: I801S

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000072848
Gene: ENSMUSG00000061950
AA Change: I801S

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 213 244 2e-5 PFAM
Pfam:HEAT 253 280 2.7e-6 PFAM
low complexity region 531 540 N/A INTRINSIC
PDB:3FGA|A 664 930 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000159646
SMART Domains Protein: ENSMUSP00000123796
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
low complexity region 92 101 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160664
AA Change: I784S

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000124690
Gene: ENSMUSG00000061950
AA Change: I784S

DomainStartEndE-ValueType
low complexity region 135 146 N/A INTRINSIC
Pfam:HEAT 236 263 2.2e-6 PFAM
low complexity region 514 523 N/A INTRINSIC
PDB:3FGA|A 647 913 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000162109
SMART Domains Protein: ENSMUSP00000125220
Gene: ENSMUSG00000061950

DomainStartEndE-ValueType
low complexity region 152 163 N/A INTRINSIC
Pfam:HEAT 253 280 7.1e-7 PFAM
Pfam:HEAT 292 322 2.1e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162703
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several alternate regulatory subunits of serine/threonine protein phosphatase 4 (PP4). The protein features multiple HEAT repeats. This protein forms a complex with PP4RC. This complex may have a distinct role from other PP4 complexes, including regulation of HDAC3 (Zhang et al., PMID: 15805470). There is also a transcribed pseudogene on chromosome 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,543,548 I102N probably benign Het
1700080E11Rik A T 9: 105,144,422 W142R probably damaging Het
6430550D23Rik T C 2: 156,003,928 H3R unknown Het
Adam18 T A 8: 24,646,305 E400V possibly damaging Het
Ak5 A T 3: 152,478,352 F473I probably damaging Het
Arhgef10l G A 4: 140,562,804 P486S probably damaging Het
Asphd1 T A 7: 126,948,829 R101W possibly damaging Het
Bhlha15 G A 5: 144,191,405 E112K probably damaging Het
C4b A T 17: 34,742,390 D198E possibly damaging Het
Carmil1 G T 13: 24,044,311 P961T probably damaging Het
Catsperb T C 12: 101,588,023 S659P possibly damaging Het
Cdh3 C T 8: 106,536,609 R97* probably null Het
Cep192 T C 18: 67,856,197 I1805T probably damaging Het
Cep250 T G 2: 155,981,411 L995R probably damaging Het
Cfap53 T C 18: 74,283,223 V9A possibly damaging Het
Chd5 A G 4: 152,368,012 K809E possibly damaging Het
Csmd3 T C 15: 47,695,734 T1467A Het
Ctla2a T A 13: 60,935,649 R60S probably damaging Het
Cts6 A T 13: 61,202,200 D22E possibly damaging Het
Ctsll3 T A 13: 60,800,718 E109V probably benign Het
Dgka G A 10: 128,720,725 P701S possibly damaging Het
Dnhd1 A T 7: 105,705,297 I3089F possibly damaging Het
Dock2 T A 11: 34,718,989 D208V probably benign Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Fnbp1l G T 3: 122,544,637 Q520K probably benign Het
Foxc1 A G 13: 31,807,635 D143G probably damaging Het
Fsip2 G A 2: 82,985,257 R3778Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gm4871 A T 5: 145,032,698 C4S probably damaging Het
Gpt C A 15: 76,698,517 T294K probably benign Het
Hsd17b4 G T 18: 50,146,424 G157C probably damaging Het
Iars G A 13: 49,728,677 E1066K probably benign Het
Ifih1 G A 2: 62,623,488 T260I possibly damaging Het
Ighv5-8 TATATATATATATATATATATA TATATATATATATATATATATATA 12: 113,654,945 probably null Het
Kif20a A G 18: 34,627,676 T166A probably damaging Het
Map3k1 G A 13: 111,755,208 A1171V probably damaging Het
Map3k21 T C 8: 125,935,116 F484S probably damaging Het
Mbnl1 A T 3: 60,615,630 Q180L probably benign Het
Mmp2 T C 8: 92,836,127 F331L possibly damaging Het
Ms4a7 G T 19: 11,321,552 H257N probably benign Het
Mtbp T A 15: 55,569,151 S285T probably benign Het
Myo1c A G 11: 75,671,242 N852S probably benign Het
Myom3 T A 4: 135,783,118 F574Y probably damaging Het
Nbeal2 A G 9: 110,628,032 I2322T possibly damaging Het
Nlrp10 A G 7: 108,924,692 L527P probably damaging Het
Nxnl1 C T 8: 71,566,461 G40D probably damaging Het
Olfr312 C T 11: 58,831,289 T45M probably benign Het
Otof A T 5: 30,375,707 W1564R probably damaging Het
Pcdhga7 A G 18: 37,717,274 Y778C probably benign Het
Pdpr T A 8: 111,112,753 N169K possibly damaging Het
Pkd1l2 C A 8: 117,035,902 V1379F possibly damaging Het
Ppp4r4 A T 12: 103,612,806 probably null Het
Prl2c5 A G 13: 13,191,742 D202G probably benign Het
Rap1gap2 T C 11: 74,414,411 T323A probably benign Het
Rapgef4 T C 2: 72,205,666 M501T probably benign Het
Rbm6 A G 9: 107,852,519 M310T probably benign Het
Rdh1 A T 10: 127,760,178 I81F probably benign Het
Rock1 C T 18: 10,097,599 A730T possibly damaging Het
Rsl1 C T 13: 67,182,037 T183I possibly damaging Het
Skiv2l2 A T 13: 112,921,686 D70E probably benign Het
Snap29 T C 16: 17,419,372 F116L probably damaging Het
Tat T C 8: 109,997,568 L363P probably damaging Het
Ttn A G 2: 76,770,972 V18719A possibly damaging Het
Ube2e2 T A 14: 18,630,339 D107V probably damaging Het
Vmn1r64 A G 7: 5,884,014 S177P possibly damaging Het
Vmn1r91 A T 7: 20,101,770 T205S possibly damaging Het
Vmn2r124 T C 17: 18,062,685 W214R probably damaging Het
Vmn2r25 A T 6: 123,823,539 F615I probably damaging Het
Vmn2r91 G T 17: 18,135,798 V576L probably benign Het
Vsig10l A C 7: 43,468,007 T573P probably damaging Het
Wdr93 A G 7: 79,766,424 Q276R probably null Het
Zc3h7b T C 15: 81,769,153 V86A possibly damaging Het
Zeb1 T A 18: 5,761,394 Y231N probably damaging Het
Zfp407 T C 18: 84,561,819 K390E possibly damaging Het
Other mutations in Ppp4r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ppp4r1 APN 17 65816019 missense probably benign 0.06
IGL01415:Ppp4r1 APN 17 65813527 missense probably damaging 1.00
IGL02166:Ppp4r1 APN 17 65813492 missense probably benign 0.01
IGL02672:Ppp4r1 APN 17 65840947 missense probably damaging 1.00
R0304:Ppp4r1 UTSW 17 65816006 missense probably benign
R0976:Ppp4r1 UTSW 17 65841018 makesense probably null
R1355:Ppp4r1 UTSW 17 65840987 missense probably benign
R2356:Ppp4r1 UTSW 17 65833050 missense probably damaging 0.99
R2405:Ppp4r1 UTSW 17 65811346 missense possibly damaging 0.95
R3054:Ppp4r1 UTSW 17 65836079 missense probably damaging 0.99
R4391:Ppp4r1 UTSW 17 65824754 missense probably benign 0.05
R4603:Ppp4r1 UTSW 17 65813464 missense probably damaging 1.00
R4763:Ppp4r1 UTSW 17 65835110 missense possibly damaging 0.90
R5571:Ppp4r1 UTSW 17 65803861 nonsense probably null
R5586:Ppp4r1 UTSW 17 65824568 missense probably benign 0.00
R5661:Ppp4r1 UTSW 17 65803968 critical splice donor site probably null
R5742:Ppp4r1 UTSW 17 65837746 missense probably damaging 0.97
R5971:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6079:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6138:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
R6303:Ppp4r1 UTSW 17 65824729 missense probably benign 0.10
R6684:Ppp4r1 UTSW 17 65824342 missense probably benign 0.00
R7058:Ppp4r1 UTSW 17 65829500 missense probably benign 0.00
R7448:Ppp4r1 UTSW 17 65840941 missense probably damaging 1.00
R7465:Ppp4r1 UTSW 17 65831020 nonsense probably null
R7528:Ppp4r1 UTSW 17 65813498 missense probably damaging 1.00
R7571:Ppp4r1 UTSW 17 65810616 missense possibly damaging 0.91
U15987:Ppp4r1 UTSW 17 65814348 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCAGCACAAAAGTCAGCTTGG -3'
(R):5'- TGGACACCTGCCAAAATTCTC -3'

Sequencing Primer
(F):5'- AGTACACTGTAGCTGTCTTCAGAC -3'
(R):5'- GCCAAAATTCTCTACCAGCTCATTG -3'
Posted On2019-09-13