Incidental Mutation 'R7398:Slc24a5'
ID573949
Institutional Source Beutler Lab
Gene Symbol Slc24a5
Ensembl Gene ENSMUSG00000035183
Gene Namesolute carrier family 24, member 5
SynonymsOca6, NCX5, F630045L20Rik, NCKX5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125068124-125088677 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 125085774 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 331 (W331*)
Ref Sequence ENSEMBL: ENSMUSP00000063887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067780] [ENSMUST00000070353] [ENSMUST00000110501] [ENSMUST00000142718] [ENSMUST00000147105] [ENSMUST00000152367]
Predicted Effect probably benign
Transcript: ENSMUST00000067780
SMART Domains Protein: ENSMUSP00000066312
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably null
Transcript: ENSMUST00000070353
AA Change: W331*
SMART Domains Protein: ENSMUSP00000063887
Gene: ENSMUSG00000035183
AA Change: W331*

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
Pfam:Na_Ca_ex 72 216 1.1e-24 PFAM
low complexity region 274 290 N/A INTRINSIC
low complexity region 311 324 N/A INTRINSIC
Pfam:Na_Ca_ex 334 485 7.6e-31 PFAM
low complexity region 488 500 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089825
SMART Domains Protein: ENSMUSP00000087258
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 48 121 1.84e-22 SMART
low complexity region 154 167 N/A INTRINSIC
RRM 181 253 5.12e-21 SMART
low complexity region 274 291 N/A INTRINSIC
low complexity region 386 406 N/A INTRINSIC
RRM 454 525 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110501
SMART Domains Protein: ENSMUSP00000106127
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 430 450 N/A INTRINSIC
RRM 498 569 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142718
SMART Domains Protein: ENSMUSP00000115519
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
RRM 491 562 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147105
SMART Domains Protein: ENSMUSP00000114817
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 410 426 N/A INTRINSIC
RRM 474 545 6.15e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152367
SMART Domains Protein: ENSMUSP00000123088
Gene: ENSMUSG00000027201

DomainStartEndE-ValueType
RRM 92 165 1.84e-22 SMART
low complexity region 198 211 N/A INTRINSIC
RRM 225 297 5.12e-21 SMART
low complexity region 318 335 N/A INTRINSIC
low complexity region 351 376 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
RRM 515 586 6.15e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the potassium-dependent sodium/calcium exchanger family and encodes an intracellular membrane protein with 2 large hydrophilic loops and 2 sets of multiple transmembrane-spanning segments. Sequence variation in this gene has been associated with differences in skin pigmentation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypopigmentation and ocular albinism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Slc24a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Slc24a5 APN 2 125080889 missense probably damaging 1.00
IGL01307:Slc24a5 APN 2 125080880 missense probably damaging 1.00
IGL01926:Slc24a5 APN 2 125068903 missense probably benign 0.01
IGL02090:Slc24a5 APN 2 125068298 missense probably benign 0.25
IGL02313:Slc24a5 APN 2 125085647 unclassified probably benign
IGL02328:Slc24a5 APN 2 125080639 missense probably damaging 1.00
IGL02743:Slc24a5 APN 2 125088234 missense probably damaging 1.00
IGL02969:Slc24a5 APN 2 125083227 missense probably damaging 1.00
IGL03212:Slc24a5 APN 2 125080830 missense probably damaging 1.00
IGL03258:Slc24a5 APN 2 125080705 critical splice donor site probably null
R0344:Slc24a5 UTSW 2 125085701 missense probably benign 0.03
R0811:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R0812:Slc24a5 UTSW 2 125068804 missense probably damaging 0.98
R1018:Slc24a5 UTSW 2 125068907 missense probably damaging 1.00
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1574:Slc24a5 UTSW 2 125080862 missense probably damaging 0.96
R1753:Slc24a5 UTSW 2 125083195 missense possibly damaging 0.53
R2147:Slc24a5 UTSW 2 125087441 missense probably damaging 1.00
R4934:Slc24a5 UTSW 2 125088020 missense probably damaging 1.00
R4964:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R4966:Slc24a5 UTSW 2 125068268 missense probably benign 0.20
R5225:Slc24a5 UTSW 2 125085819 missense probably damaging 0.99
R5275:Slc24a5 UTSW 2 125085861 missense probably benign 0.09
R5438:Slc24a5 UTSW 2 125068865 missense probably damaging 1.00
R5866:Slc24a5 UTSW 2 125085671 missense probably damaging 1.00
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6038:Slc24a5 UTSW 2 125085731 missense probably benign 0.04
R6114:Slc24a5 UTSW 2 125083092 missense probably benign 0.01
R6211:Slc24a5 UTSW 2 125088251 missense probably benign 0.23
R6516:Slc24a5 UTSW 2 125088107 missense probably benign 0.01
R6675:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6677:Slc24a5 UTSW 2 125080695 missense possibly damaging 0.82
R6826:Slc24a5 UTSW 2 125068858 missense probably benign 0.00
R7100:Slc24a5 UTSW 2 125080671 missense probably damaging 1.00
R7122:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
R7381:Slc24a5 UTSW 2 125068949 missense probably benign 0.29
R7401:Slc24a5 UTSW 2 125088191 missense probably benign 0.15
X0067:Slc24a5 UTSW 2 125087503 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGGCCTTTCTAACATAATTGCAC -3'
(R):5'- AAAACATGAATGAGCTTGCTGG -3'

Sequencing Primer
(F):5'- GCCTTTCTAACATAATTGCACATTTG -3'
(R):5'- AAACATGAATGAGCTTGCTGGTTTTG -3'
Posted On2019-09-13