Incidental Mutation 'R7398:Brinp1'
ID573956
Institutional Source Beutler Lab
Gene Symbol Brinp1
Ensembl Gene ENSMUSG00000028351
Gene Namebone morphogenic protein/retinoic acid inducible neural specific 1
SynonymsDbc1, Dbccr1, Fam5a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location68761514-68954397 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 68841354 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 91 (V91A)
Ref Sequence ENSEMBL: ENSMUSP00000030036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030036]
Predicted Effect probably benign
Transcript: ENSMUST00000030036
AA Change: V91A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030036
Gene: ENSMUSG00000028351
AA Change: V91A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MACPF 72 251 2.35e-46 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within a chromosomal region that shows loss of heterozygosity in some bladder cancers. It contains a 5' CpG island that may be a frequent target of hypermethylation, and it may undergo hypermethylation-based silencing in some bladder cancers. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show increased adult neurogenesis in the subgranular zone of the dentate gyrus, altered neuronal differentiation in the hippocampus, and behavioral anomalies such as hyperactivity, reduced anxiety-like behaviors, poor social interaction, and a slight deficit in working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Brinp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Brinp1 APN 4 68762847 missense probably damaging 1.00
IGL01024:Brinp1 APN 4 68762494 missense probably damaging 1.00
IGL02048:Brinp1 APN 4 68763142 missense probably benign
IGL02115:Brinp1 APN 4 68762398 missense probably benign 0.03
IGL02332:Brinp1 APN 4 68904884 missense probably benign 0.00
IGL03115:Brinp1 APN 4 68904736 critical splice donor site probably null
IGL02796:Brinp1 UTSW 4 68762190 missense probably damaging 1.00
R0382:Brinp1 UTSW 4 68762308 missense possibly damaging 0.68
R0468:Brinp1 UTSW 4 68762776 missense probably damaging 1.00
R1141:Brinp1 UTSW 4 68792978 missense probably benign 0.00
R1164:Brinp1 UTSW 4 68798691 missense probably benign
R1178:Brinp1 UTSW 4 68762553 missense probably damaging 1.00
R1545:Brinp1 UTSW 4 68762955 missense possibly damaging 0.67
R1672:Brinp1 UTSW 4 68829283 splice site probably null
R1998:Brinp1 UTSW 4 68762553 missense probably damaging 1.00
R2218:Brinp1 UTSW 4 68762715 missense probably damaging 1.00
R2262:Brinp1 UTSW 4 68829354 missense probably damaging 1.00
R2370:Brinp1 UTSW 4 68762947 missense probably damaging 1.00
R4542:Brinp1 UTSW 4 68762092 missense probably benign 0.00
R4617:Brinp1 UTSW 4 68762961 missense possibly damaging 0.94
R4864:Brinp1 UTSW 4 68798886 missense probably damaging 1.00
R5287:Brinp1 UTSW 4 68792964 missense probably benign 0.04
R5403:Brinp1 UTSW 4 68792964 missense probably benign 0.04
R5932:Brinp1 UTSW 4 68792941 missense probably benign 0.00
R7106:Brinp1 UTSW 4 68829378 missense probably benign 0.36
R7127:Brinp1 UTSW 4 68793023 missense probably benign 0.00
Z1176:Brinp1 UTSW 4 68798751 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GATGGAATCATGGTTCAGTAGCTG -3'
(R):5'- CCCAGGGACCACAGTAATTCTC -3'

Sequencing Primer
(F):5'- AATCATGGTTCAGTAGCTGCTGAC -3'
(R):5'- CAGCCTAGTCTGACTACATAGTGAG -3'
Posted On2019-09-13