Incidental Mutation 'R7398:Olfr1337'
ID573958
Institutional Source Beutler Lab
Gene Symbol Olfr1337
Ensembl Gene ENSMUSG00000111159
Gene Nameolfactory receptor 1337
SynonymsGA_x6K02T2QD9B-18767132-18768073, Olfr219-ps1, GA_x6K02SYWGW3-414-3, MOR259-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location118781636-118782586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 118781699 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 295 (L295F)
Ref Sequence ENSEMBL: ENSMUSP00000076483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077247]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077247
AA Change: L295F

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000076483
Gene: ENSMUSG00000111159
AA Change: L295F

DomainStartEndE-ValueType
Pfam:7tm_4 34 310 7.8e-53 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.5e-7 PFAM
Pfam:7tm_1 44 293 8.3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Olfr1337
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02203:Olfr1337 APN 4 118782429 missense possibly damaging 0.95
IGL02626:Olfr1337 APN 4 118782334 missense probably damaging 0.98
IGL02699:Olfr1337 APN 4 118782152 nonsense probably null
IGL02754:Olfr1337 APN 4 118781920 missense possibly damaging 0.90
IGL03287:Olfr1337 APN 4 118782354 missense possibly damaging 0.64
R1341:Olfr1337 UTSW 4 118782382 missense probably benign 0.01
R4894:Olfr1337 UTSW 4 118782286 missense probably damaging 1.00
R6124:Olfr1337 UTSW 4 118782195 missense probably damaging 1.00
R6515:Olfr1337 UTSW 4 118782270 missense probably benign 0.13
R6529:Olfr1337 UTSW 4 118781710 missense probably benign 0.15
R7040:Olfr1337 UTSW 4 118781986 missense probably benign 0.00
R7684:Olfr1337 UTSW 4 118782274 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- CAGGACAACAATGTTGGTTTCATGATG -3'
(R):5'- AGATCAAGTCCAACCAGGGC -3'

Sequencing Primer
(F):5'- AACAATGTTGGTTTCATGATGTTTTG -3'
(R):5'- GCCGTTGCAAGGCTTTC -3'
Posted On2019-09-13