Incidental Mutation 'R7398:Dgkq'
ID573959
Institutional Source Beutler Lab
Gene Symbol Dgkq
Ensembl Gene ENSMUSG00000004815
Gene Namediacylglycerol kinase, theta
Synonyms110kDa, DAGK7, Dagk4, Dgkd, Dgk theta
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location108646693-108669672 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108655190 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 298 (I298T)
Ref Sequence ENSEMBL: ENSMUSP00000057859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053913] [ENSMUST00000132179] [ENSMUST00000132708] [ENSMUST00000153238]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053913
AA Change: I298T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057859
Gene: ENSMUSG00000004815
AA Change: I298T

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
C1 114 162 1.73e-2 SMART
C1 178 228 1.58e-13 SMART
low complexity region 267 275 N/A INTRINSIC
RA 387 486 2.08e-20 SMART
DAGKc 580 707 4.79e-63 SMART
DAGKa 733 885 7e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132179
SMART Domains Protein: ENSMUSP00000118466
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132708
SMART Domains Protein: ENSMUSP00000122837
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
Blast:C1 26 56 2e-13 BLAST
low complexity region 68 81 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153238
SMART Domains Protein: ENSMUSP00000118065
Gene: ENSMUSG00000004815

DomainStartEndE-ValueType
C1 55 102 3.22e-14 SMART
Blast:C1 114 144 1e-12 BLAST
low complexity region 156 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains three cysteine-rich domains, a proline-rich region, and a pleckstrin homology domain with an overlapping Ras-associating domain. It is localized in the speckle domains of the nucleus, and mediates the regeneration of phosphatidylinositol (PI) from diacylglycerol in the PI-cycle during cell signal transduction. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Dgkq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Dgkq APN 5 108654582 missense possibly damaging 0.72
IGL02364:Dgkq APN 5 108656444 missense probably benign 0.05
IGL02966:Dgkq APN 5 108656421 splice site probably null
IGL03297:Dgkq APN 5 108650274 missense probably damaging 1.00
R0179:Dgkq UTSW 5 108658200 splice site probably benign
R0194:Dgkq UTSW 5 108654644 intron probably benign
R0332:Dgkq UTSW 5 108655099 splice site probably benign
R0513:Dgkq UTSW 5 108656495 missense probably benign 0.02
R0525:Dgkq UTSW 5 108654615 missense probably damaging 1.00
R0673:Dgkq UTSW 5 108655589 missense probably damaging 0.97
R0801:Dgkq UTSW 5 108660720 utr 5 prime probably null
R0850:Dgkq UTSW 5 108654578 missense possibly damaging 0.82
R0944:Dgkq UTSW 5 108656465 missense probably damaging 1.00
R1069:Dgkq UTSW 5 108656037 splice site probably benign
R1411:Dgkq UTSW 5 108650362 missense probably damaging 1.00
R1488:Dgkq UTSW 5 108650877 missense probably damaging 1.00
R1858:Dgkq UTSW 5 108653731 missense probably benign 0.00
R1874:Dgkq UTSW 5 108660595 missense probably benign 0.07
R2210:Dgkq UTSW 5 108660523 missense probably damaging 1.00
R4499:Dgkq UTSW 5 108649661 missense possibly damaging 0.54
R5061:Dgkq UTSW 5 108654123 missense probably benign 0.02
R5474:Dgkq UTSW 5 108649143 critical splice donor site probably null
R5481:Dgkq UTSW 5 108648810 unclassified probably null
R5951:Dgkq UTSW 5 108654370 missense probably damaging 1.00
R6193:Dgkq UTSW 5 108655500 nonsense probably null
R6429:Dgkq UTSW 5 108653708 missense probably damaging 1.00
R6458:Dgkq UTSW 5 108654376 missense possibly damaging 0.93
R7388:Dgkq UTSW 5 108658246 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCTGTAGAGGGTAAAGACGC -3'
(R):5'- AAGGGCTTTGTCTGTCCTGC -3'

Sequencing Primer
(F):5'- TCCTGTAGAGGGTAAAGACGCATATG -3'
(R):5'- CTGTCCTGCAGGTGATGG -3'
Posted On2019-09-13