Incidental Mutation 'R7398:Ccne1'
ID573962
Institutional Source Beutler Lab
Gene Symbol Ccne1
Ensembl Gene ENSMUSG00000002068
Gene Namecyclin E1
SynonymsCycE1, cyclin E
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location38097984-38107534 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 38106277 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108023] [ENSMUST00000124979] [ENSMUST00000130329]
Predicted Effect probably null
Transcript: ENSMUST00000108023
SMART Domains Protein: ENSMUSP00000103658
Gene: ENSMUSG00000002068

DomainStartEndE-ValueType
CYCLIN 148 233 5.88e-26 SMART
Cyclin_C 242 364 2.36e-13 SMART
low complexity region 385 408 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124979
Predicted Effect probably null
Transcript: ENSMUST00000130329
SMART Domains Protein: ENSMUSP00000117662
Gene: ENSMUSG00000002068

DomainStartEndE-ValueType
Pfam:Cyclin_N 113 167 5.4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2, whose activity is required for cell cycle G1/S transition. This protein accumulates at the G1-S phase boundary and is degraded as cells progress through S phase. Overexpression of this gene has been observed in many tumors, which results in chromosome instability, and thus may contribute to tumorigenesis. This protein was found to associate with, and be involved in, the phosphorylation of NPAT protein (nuclear protein mapped to the ATM locus), which participates in cell-cycle regulated histone gene expression and plays a critical role in promoting cell-cycle progression in the absence of pRB. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene display no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Ccne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Ccne1 APN 7 38106301 missense probably benign 0.22
IGL02377:Ccne1 APN 7 38098990 critical splice donor site probably null
IGL02800:Ccne1 APN 7 38102799 missense probably damaging 1.00
R1355:Ccne1 UTSW 7 38106322 missense possibly damaging 0.80
R1938:Ccne1 UTSW 7 38106277 critical splice donor site probably null
R4810:Ccne1 UTSW 7 38099593 missense probably damaging 1.00
R4858:Ccne1 UTSW 7 38099319 missense probably damaging 1.00
R4982:Ccne1 UTSW 7 38100571 missense probably damaging 1.00
R6480:Ccne1 UTSW 7 38106854 start gained probably benign
R6981:Ccne1 UTSW 7 38098573 unclassified probably benign
R7165:Ccne1 UTSW 7 38099301 missense probably damaging 1.00
R7458:Ccne1 UTSW 7 38100671 missense probably damaging 1.00
R7835:Ccne1 UTSW 7 38102845 missense probably benign 0.03
R7918:Ccne1 UTSW 7 38102845 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGTTCCTCCAGGTATCAGTAC -3'
(R):5'- CTTTAGTTGAATGTCGTTCATGACC -3'

Sequencing Primer
(F):5'- GGTATCAGTACCTGTAACCTTAAAGG -3'
(R):5'- GAATGTCGTTCATGACCTAACAAAC -3'
Posted On2019-09-13