Incidental Mutation 'R7398:Sult2b1'
ID573963
Institutional Source Beutler Lab
Gene Symbol Sult2b1
Ensembl Gene ENSMUSG00000003271
Gene Namesulfotransferase family, cytosolic, 2B, member 1
SynonymsSULT2B
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location45729983-45784669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45731294 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 288 (Y288C)
Ref Sequence ENSEMBL: ENSMUSP00000148064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075571] [ENSMUST00000129507] [ENSMUST00000209739] [ENSMUST00000210147] [ENSMUST00000210754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075571
AA Change: Y254C

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075005
Gene: ENSMUSG00000003271
AA Change: Y254C

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 57 302 7.8e-84 PFAM
low complexity region 309 337 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129507
SMART Domains Protein: ENSMUSP00000114397
Gene: ENSMUSG00000054161

DomainStartEndE-ValueType
Pfam:DUF1669 18 293 4.8e-105 PFAM
low complexity region 371 385 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209739
AA Change: Y286C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000210147
Predicted Effect probably damaging
Transcript: ENSMUST00000210754
AA Change: Y288C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene sulfates dehydroepiandrosterone but not 4-nitrophenol, a typical substrate for the phenol and estrogen sulfotransferase subfamilies. Two alternatively spliced variants that encode different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele lack cholesterol sulfate in the dermis but otherwise appear to have normal lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Sult2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02415:Sult2b1 APN 7 45742085 missense possibly damaging 0.86
IGL02964:Sult2b1 APN 7 45735274 missense probably benign 0.01
IGL03208:Sult2b1 APN 7 45733629 missense probably damaging 1.00
R0392:Sult2b1 UTSW 7 45733638 missense probably damaging 1.00
R0415:Sult2b1 UTSW 7 45730092 unclassified probably benign
R2247:Sult2b1 UTSW 7 45735310 missense probably damaging 1.00
R3851:Sult2b1 UTSW 7 45730037 unclassified probably benign
R3935:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R3936:Sult2b1 UTSW 7 45742216 missense probably benign 0.09
R4179:Sult2b1 UTSW 7 45735311 missense probably damaging 1.00
R4723:Sult2b1 UTSW 7 45742065 missense probably damaging 1.00
R5634:Sult2b1 UTSW 7 45734082 missense probably damaging 0.99
R5782:Sult2b1 UTSW 7 45731346 missense probably damaging 1.00
R6562:Sult2b1 UTSW 7 45742246 missense probably benign 0.00
R6816:Sult2b1 UTSW 7 45733678 missense probably damaging 1.00
R6921:Sult2b1 UTSW 7 45735188 missense probably damaging 1.00
R7145:Sult2b1 UTSW 7 45733632 missense probably damaging 1.00
R7250:Sult2b1 UTSW 7 45783937 missense unknown
R7392:Sult2b1 UTSW 7 45742438 start gained probably benign
R7691:Sult2b1 UTSW 7 45735284 missense probably benign 0.01
R7712:Sult2b1 UTSW 7 45730196 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTCATGTTGTTAGAGCCCCTG -3'
(R):5'- AGGCCAAACAAAGTGGTCCC -3'

Sequencing Primer
(F):5'- TCACTTTGTCCCAGGGAGAG -3'
(R):5'- GTCCCCACTCCACTGACG -3'
Posted On2019-09-13