Incidental Mutation 'R7398:E430018J23Rik'
ID573965
Institutional Source Beutler Lab
Gene Symbol E430018J23Rik
Ensembl Gene ENSMUSG00000078580
Gene NameRIKEN cDNA E430018J23 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location127389673-127393629 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127393324 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 38 (C38Y)
Ref Sequence ENSEMBL: ENSMUSP00000073867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074249] [ENSMUST00000106303] [ENSMUST00000165495]
Predicted Effect probably null
Transcript: ENSMUST00000074249
AA Change: C38Y

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000073867
Gene: ENSMUSG00000078580
AA Change: C38Y

DomainStartEndE-ValueType
KRAB 22 79 4.43e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000106303
AA Change: C38Y

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101910
Gene: ENSMUSG00000078580
AA Change: C38Y

DomainStartEndE-ValueType
KRAB 22 81 9.25e-28 SMART
Predicted Effect probably null
Transcript: ENSMUST00000165495
AA Change: C38Y

PolyPhen 2 Score 0.193 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126288
Gene: ENSMUSG00000078580
AA Change: C38Y

DomainStartEndE-ValueType
KRAB 22 82 4.09e-29 SMART
ZnF_C2H2 168 190 2.2e-2 SMART
ZnF_C2H2 196 218 4.79e-3 SMART
ZnF_C2H2 224 246 4.3e-5 SMART
ZnF_C2H2 252 274 7.9e-4 SMART
ZnF_C2H2 280 302 9.58e-3 SMART
ZnF_C2H2 308 331 2.36e-2 SMART
ZnF_C2H2 337 359 2.57e-3 SMART
ZnF_C2H2 365 387 1.69e-3 SMART
ZnF_C2H2 393 415 2.2e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vill C T 9: 119,070,648 P767L probably benign Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in E430018J23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:E430018J23Rik APN 7 127392036 missense possibly damaging 0.92
IGL01782:E430018J23Rik APN 7 127393304 missense probably benign 0.02
IGL02174:E430018J23Rik APN 7 127392353 missense possibly damaging 0.54
IGL02882:E430018J23Rik APN 7 127392252 missense probably damaging 1.00
IGL03152:E430018J23Rik APN 7 127392297 missense probably damaging 1.00
R0552:E430018J23Rik UTSW 7 127392332 missense possibly damaging 0.92
R1828:E430018J23Rik UTSW 7 127391909 missense probably damaging 1.00
R1843:E430018J23Rik UTSW 7 127391488 missense probably benign 0.32
R1866:E430018J23Rik UTSW 7 127393331 missense probably damaging 1.00
R3429:E430018J23Rik UTSW 7 127391742 missense possibly damaging 0.79
R4433:E430018J23Rik UTSW 7 127393002 missense possibly damaging 0.75
R4933:E430018J23Rik UTSW 7 127393349 missense probably damaging 1.00
R5292:E430018J23Rik UTSW 7 127392487 missense possibly damaging 0.48
R6218:E430018J23Rik UTSW 7 127393409 missense possibly damaging 0.85
R6667:E430018J23Rik UTSW 7 127393423 missense probably benign 0.35
R6712:E430018J23Rik UTSW 7 127392310 missense probably damaging 1.00
R7108:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7214:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7215:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7216:E430018J23Rik UTSW 7 127391523 missense probably benign 0.05
R7313:E430018J23Rik UTSW 7 127391684 missense probably benign 0.23
R7396:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7397:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7478:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7479:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7480:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7481:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7512:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7652:E430018J23Rik UTSW 7 127393324 missense probably null 0.88
R7716:E430018J23Rik UTSW 7 127392087 missense probably benign
R7820:E430018J23Rik UTSW 7 127391436 missense possibly damaging 0.84
X0022:E430018J23Rik UTSW 7 127393270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCCACTTGTTACGACCAC -3'
(R):5'- CTCACGGACCTGATATATGTCC -3'

Sequencing Primer
(F):5'- ACTTGTTACGACCACCCGTAC -3'
(R):5'- GGCAACCTAGGATCTGGCAG -3'
Posted On2019-09-13